Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0408057625:

Variant ID: vg0408057625 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 8057625
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:

TTTTTTCCCGTTTTGCGTGTTAGCTTGTCGTTTCCGTCGTTTCGAATGATCGTAAGTGCATCGGAAGTGTTCAAGAAGATTAATTGAAGACCCGTTATTG[C/T]
AAGGCAAGTCACACATATCCCAAACACAGTTCCTTTGAGCATGTTGGTCCTATATTTAAATTCTCTATTTATTTCAACTGTGCATTTATTTTCGAATGTC

Reverse complement sequence

GACATTCGAAAATAAATGCACAGTTGAAATAAATAGAGAATTTAAATATAGGACCAACATGCTCAAAGGAACTGTGTTTGGGATATGTGTGACTTGCCTT[G/A]
CAATAACGGGTCTTCAATTAATCTTCTTGAACACTTCCGATGCACTTACGATCATTCGAAACGACGGAAACGACAAGCTAACACGCAAAACGGGAAAAAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	51.20%	11.70%	19.45%	17.63%	NA
All Indica	2759	39.60%	15.90%	30.95%	13.59%	NA
All Japonica	1512	64.10%	5.50%	1.65%	28.77%	NA
Aus	269	95.20%	2.20%	2.60%	0.00%	NA
Indica I	595	25.70%	6.70%	35.97%	31.60%	NA
Indica II	465	47.70%	2.40%	38.28%	11.61%	NA
Indica III	913	46.00%	31.50%	18.29%	4.16%	NA
Indica Intermediate	786	37.80%	12.60%	37.53%	12.09%	NA
Temperate Japonica	767	96.90%	0.10%	0.26%	2.74%	NA
Tropical Japonica	504	10.10%	14.70%	3.17%	72.02%	NA
Japonica Intermediate	241	72.60%	3.30%	2.90%	21.16%	NA
VI/Aromatic	96	57.30%	16.70%	16.67%	9.38%	NA
Intermediate	90	54.40%	11.10%	18.89%	15.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0408057625	C -> DEL	N	N	silent_mutation	Average:7.971; most accessible tissue: Callus, score: 11.953	N	N	N	N
vg0408057625	C -> T	LOC_Os04g14390.1	upstream_gene_variant ; 3083.0bp to feature; MODIFIER	silent_mutation	Average:7.971; most accessible tissue: Callus, score: 11.953	N	N	N	N
vg0408057625	C -> T	LOC_Os04g14400.1	upstream_gene_variant ; 4688.0bp to feature; MODIFIER	silent_mutation	Average:7.971; most accessible tissue: Callus, score: 11.953	N	N	N	N
vg0408057625	C -> T	LOC_Os04g14390-LOC_Os04g14400	intergenic_region ; MODIFIER	silent_mutation	Average:7.971; most accessible tissue: Callus, score: 11.953	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0408057625	NA	9.59E-08	mr1045	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408057625	NA	5.35E-06	mr1084	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408057625	NA	3.73E-07	mr1156	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408057625	NA	5.18E-06	mr1164	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408057625	NA	1.59E-07	mr1179	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408057625	NA	2.14E-07	mr1194	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408057625	NA	1.05E-06	mr1206	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408057625	NA	1.91E-06	mr1213	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408057625	NA	8.74E-06	mr1225	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408057625	3.42E-06	3.41E-06	mr1319	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408057625	NA	9.96E-07	mr1403	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408057625	NA	2.89E-11	mr1410	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408057625	NA	8.83E-07	mr1425	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408057625	NA	1.84E-07	mr1668	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408057625	NA	1.20E-06	mr1763	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408057625	NA	2.96E-15	mr1301_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408057625	NA	1.18E-12	mr1410_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0408057625	NA	2.79E-06	mr1873_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251