\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0407827227:

Variant ID: vg0407827227 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 7827227
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATCACTAAAATTTTGAACTTTTTAAAACTTTTGCATCATGATGGATGTTATGGTTGATATTGCTTGCCAAACTGTAAATTATCTCAATGGAAAAATCAAA[G/A]
TAAAGATGCGCATCTAAATAATAATTACAATTTACATGAATACCTTGTTATGCAAATAAGTTCAACCAACGTGCTATTGTATTAGTACTGGACCCATTGA

Reverse complement sequence

TCAATGGGTCCAGTACTAATACAATAGCACGTTGGTTGAACTTATTTGCATAACAAGGTATTCATGTAAATTGTAATTATTATTTAGATGCGCATCTTTA[C/T]
TTTGATTTTTCCATTGAGATAATTTACAGTTTGGCAAGCAATATCAACCATAACATCCATCATGATGCAAAAGTTTTAAAAAGTTCAAAATTTTAGTGAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.60% 1.60% 5.25% 53.53% NA
All Indica  2759 9.60% 2.60% 7.36% 80.50% NA
All Japonica  1512 98.90% 0.10% 0.33% 0.73% NA
Aus  269 2.20% 1.50% 12.64% 83.64% NA
Indica I  595 11.30% 0.20% 3.53% 85.04% NA
Indica II  465 12.90% 0.60% 9.03% 77.42% NA
Indica III  913 2.60% 5.70% 9.97% 81.71% NA
Indica Intermediate  786 14.40% 1.90% 6.23% 77.48% NA
Temperate Japonica  767 99.60% 0.10% 0.00% 0.26% NA
Tropical Japonica  504 98.20% 0.00% 0.79% 0.99% NA
Japonica Intermediate  241 97.90% 0.00% 0.41% 1.66% NA
VI/Aromatic  96 57.30% 0.00% 0.00% 42.71% NA
Intermediate  90 57.80% 0.00% 6.67% 35.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0407827227 G -> DEL N N silent_mutation Average:23.274; most accessible tissue: Callus, score: 69.909 N N N N
vg0407827227 G -> A LOC_Os04g14000.1 downstream_gene_variant ; 2031.0bp to feature; MODIFIER silent_mutation Average:23.274; most accessible tissue: Callus, score: 69.909 N N N N
vg0407827227 G -> A LOC_Os04g14010.1 downstream_gene_variant ; 888.0bp to feature; MODIFIER silent_mutation Average:23.274; most accessible tissue: Callus, score: 69.909 N N N N
vg0407827227 G -> A LOC_Os04g14020.1 downstream_gene_variant ; 659.0bp to feature; MODIFIER silent_mutation Average:23.274; most accessible tissue: Callus, score: 69.909 N N N N
vg0407827227 G -> A LOC_Os04g14010-LOC_Os04g14020 intergenic_region ; MODIFIER silent_mutation Average:23.274; most accessible tissue: Callus, score: 69.909 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0407827227 NA 9.81E-12 mr1026 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407827227 NA 6.28E-07 mr1113 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407827227 NA 5.37E-06 mr1114 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407827227 NA 1.04E-20 mr1118 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407827227 NA 2.60E-12 mr1118 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407827227 NA 9.22E-06 mr1120 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407827227 NA 4.21E-13 mr1161 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407827227 NA 2.49E-06 mr1247 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407827227 NA 6.41E-30 mr1495 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407827227 NA 5.24E-12 mr1495 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407827227 NA 1.21E-09 mr1794 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407827227 NA 2.21E-11 mr1902 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407827227 NA 8.04E-26 mr1118_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407827227 NA 1.61E-19 mr1118_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407827227 NA 6.06E-07 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407827227 NA 4.55E-14 mr1161_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407827227 NA 5.83E-06 mr1247_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407827227 NA 7.81E-38 mr1495_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407827227 NA 1.98E-20 mr1495_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407827227 NA 7.19E-14 mr1496_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407827227 NA 6.04E-07 mr1531_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407827227 NA 2.17E-12 mr1794_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407827227 NA 1.60E-17 mr1936_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407827227 NA 3.34E-07 mr1936_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251