Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0407827227:

Variant ID: vg0407827227 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 7827227
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATCACTAAAATTTTGAACTTTTTAAAACTTTTGCATCATGATGGATGTTATGGTTGATATTGCTTGCCAAACTGTAAATTATCTCAATGGAAAAATCAAA[G/A]
TAAAGATGCGCATCTAAATAATAATTACAATTTACATGAATACCTTGTTATGCAAATAAGTTCAACCAACGTGCTATTGTATTAGTACTGGACCCATTGA

Reverse complement sequence

TCAATGGGTCCAGTACTAATACAATAGCACGTTGGTTGAACTTATTTGCATAACAAGGTATTCATGTAAATTGTAATTATTATTTAGATGCGCATCTTTA[C/T]
TTTGATTTTTCCATTGAGATAATTTACAGTTTGGCAAGCAATATCAACCATAACATCCATCATGATGCAAAAGTTTTAAAAAGTTCAAAATTTTAGTGAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	39.60%	1.60%	5.25%	53.53%	NA
All Indica	2759	9.60%	2.60%	7.36%	80.50%	NA
All Japonica	1512	98.90%	0.10%	0.33%	0.73%	NA
Aus	269	2.20%	1.50%	12.64%	83.64%	NA
Indica I	595	11.30%	0.20%	3.53%	85.04%	NA
Indica II	465	12.90%	0.60%	9.03%	77.42%	NA
Indica III	913	2.60%	5.70%	9.97%	81.71%	NA
Indica Intermediate	786	14.40%	1.90%	6.23%	77.48%	NA
Temperate Japonica	767	99.60%	0.10%	0.00%	0.26%	NA
Tropical Japonica	504	98.20%	0.00%	0.79%	0.99%	NA
Japonica Intermediate	241	97.90%	0.00%	0.41%	1.66%	NA
VI/Aromatic	96	57.30%	0.00%	0.00%	42.71%	NA
Intermediate	90	57.80%	0.00%	6.67%	35.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0407827227	G -> DEL	N	N	silent_mutation	Average:23.274; most accessible tissue: Callus, score: 69.909	N	N	N	N
vg0407827227	G -> A	LOC_Os04g14000.1	downstream_gene_variant ; 2031.0bp to feature; MODIFIER	silent_mutation	Average:23.274; most accessible tissue: Callus, score: 69.909	N	N	N	N
vg0407827227	G -> A	LOC_Os04g14010.1	downstream_gene_variant ; 888.0bp to feature; MODIFIER	silent_mutation	Average:23.274; most accessible tissue: Callus, score: 69.909	N	N	N	N
vg0407827227	G -> A	LOC_Os04g14020.1	downstream_gene_variant ; 659.0bp to feature; MODIFIER	silent_mutation	Average:23.274; most accessible tissue: Callus, score: 69.909	N	N	N	N
vg0407827227	G -> A	LOC_Os04g14010-LOC_Os04g14020	intergenic_region ; MODIFIER	silent_mutation	Average:23.274; most accessible tissue: Callus, score: 69.909	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0407827227	NA	9.81E-12	mr1026	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407827227	NA	6.28E-07	mr1113	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407827227	NA	5.37E-06	mr1114	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407827227	NA	1.04E-20	mr1118	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407827227	NA	2.60E-12	mr1118	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407827227	NA	9.22E-06	mr1120	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407827227	NA	4.21E-13	mr1161	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407827227	NA	2.49E-06	mr1247	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407827227	NA	6.41E-30	mr1495	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407827227	NA	5.24E-12	mr1495	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407827227	NA	1.21E-09	mr1794	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407827227	NA	2.21E-11	mr1902	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407827227	NA	8.04E-26	mr1118_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407827227	NA	1.61E-19	mr1118_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407827227	NA	6.06E-07	mr1120_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407827227	NA	4.55E-14	mr1161_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407827227	NA	5.83E-06	mr1247_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407827227	NA	7.81E-38	mr1495_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407827227	NA	1.98E-20	mr1495_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407827227	NA	7.19E-14	mr1496_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407827227	NA	6.04E-07	mr1531_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407827227	NA	2.17E-12	mr1794_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407827227	NA	1.60E-17	mr1936_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407827227	NA	3.34E-07	mr1936_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251