\
| Variant ID: vg0407789423 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 7789423 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TTGTACTCCTTTGCATTTATGCTGCACTTGTGGGTGTGTCTTGTTGAGTATGGTGGTTGTACTCAGTCTTGCTCAATTTTTCCCAAACCCAGAAGAGGAG[G/C]
CCCTGGATGATGAAGGCTTTGGTGTCTAGCTCGTGCCTGCCGTCAAGCGCCTGTGGTCATCGCCTTAGTCTTCCGCTGTTTTTCGTTGTCTTTGAGTGTG
CACACTCAAAGACAACGAAAAACAGCGGAAGACTAAGGCGATGACCACAGGCGCTTGACGGCAGGCACGAGCTAGACACCAAAGCCTTCATCATCCAGGG[C/G]
CTCCTCTTCTGGGTTTGGGAAAAATTGAGCAAGACTGAGTACAACCACCATACTCAACAAGACACACCCACAAGTGCAGCATAAATGCAAAGGAGTACAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 30.00% | 11.40% | 3.55% | 55.01% | NA |
| All Indica | 2759 | 11.80% | 0.60% | 4.97% | 82.64% | NA |
| All Japonica | 1512 | 65.90% | 32.80% | 0.13% | 1.19% | NA |
| Aus | 269 | 3.30% | 0.40% | 8.92% | 87.36% | NA |
| Indica I | 595 | 18.50% | 0.30% | 5.88% | 75.29% | NA |
| Indica II | 465 | 13.50% | 1.30% | 3.66% | 81.51% | NA |
| Indica III | 913 | 2.40% | 0.40% | 3.50% | 93.65% | NA |
| Indica Intermediate | 786 | 16.50% | 0.60% | 6.74% | 76.08% | NA |
| Temperate Japonica | 767 | 96.30% | 3.30% | 0.00% | 0.39% | NA |
| Tropical Japonica | 504 | 16.30% | 81.30% | 0.40% | 1.98% | NA |
| Japonica Intermediate | 241 | 72.60% | 25.30% | 0.00% | 2.07% | NA |
| VI/Aromatic | 96 | 55.20% | 6.20% | 4.17% | 34.38% | NA |
| Intermediate | 90 | 41.10% | 20.00% | 1.11% | 37.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0407789423 | G -> C | LOC_Os04g13940.1 | upstream_gene_variant ; 803.0bp to feature; MODIFIER | silent_mutation | Average:11.465; most accessible tissue: Zhenshan97 panicle, score: 24.575 | N | N | N | N |
| vg0407789423 | G -> C | LOC_Os04g13950.1 | upstream_gene_variant ; 4584.0bp to feature; MODIFIER | silent_mutation | Average:11.465; most accessible tissue: Zhenshan97 panicle, score: 24.575 | N | N | N | N |
| vg0407789423 | G -> C | LOC_Os04g13930.1 | downstream_gene_variant ; 2837.0bp to feature; MODIFIER | silent_mutation | Average:11.465; most accessible tissue: Zhenshan97 panicle, score: 24.575 | N | N | N | N |
| vg0407789423 | G -> C | LOC_Os04g13930-LOC_Os04g13940 | intergenic_region ; MODIFIER | silent_mutation | Average:11.465; most accessible tissue: Zhenshan97 panicle, score: 24.575 | N | N | N | N |
| vg0407789423 | G -> DEL | N | N | silent_mutation | Average:11.465; most accessible tissue: Zhenshan97 panicle, score: 24.575 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0407789423 | NA | 2.85E-06 | mr1047 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407789423 | NA | 6.75E-21 | mr1301 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407789423 | NA | 5.82E-14 | mr1301 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407789423 | NA | 3.19E-07 | mr1338 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407789423 | NA | 8.42E-14 | mr1410 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407789423 | NA | 2.84E-12 | mr1454 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407789423 | NA | 1.42E-10 | mr1454 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407789423 | NA | 2.63E-06 | mr1471 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407789423 | NA | 2.34E-08 | mr1539 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407789423 | NA | 3.15E-12 | mr1540 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407789423 | NA | 7.33E-13 | mr1732 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407789423 | NA | 7.88E-24 | mr1301_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407789423 | NA | 2.69E-16 | mr1301_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407789423 | NA | 1.12E-15 | mr1410_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407789423 | NA | 8.97E-13 | mr1993_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |