Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0407789423:

Variant ID: vg0407789423 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 7789423
Reference Allele: G	Alternative Allele: C
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTGTACTCCTTTGCATTTATGCTGCACTTGTGGGTGTGTCTTGTTGAGTATGGTGGTTGTACTCAGTCTTGCTCAATTTTTCCCAAACCCAGAAGAGGAG[G/C]
CCCTGGATGATGAAGGCTTTGGTGTCTAGCTCGTGCCTGCCGTCAAGCGCCTGTGGTCATCGCCTTAGTCTTCCGCTGTTTTTCGTTGTCTTTGAGTGTG

Reverse complement sequence

CACACTCAAAGACAACGAAAAACAGCGGAAGACTAAGGCGATGACCACAGGCGCTTGACGGCAGGCACGAGCTAGACACCAAAGCCTTCATCATCCAGGG[C/G]
CTCCTCTTCTGGGTTTGGGAAAAATTGAGCAAGACTGAGTACAACCACCATACTCAACAAGACACACCCACAAGTGCAGCATAAATGCAAAGGAGTACAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	30.00%	11.40%	3.55%	55.01%	NA
All Indica	2759	11.80%	0.60%	4.97%	82.64%	NA
All Japonica	1512	65.90%	32.80%	0.13%	1.19%	NA
Aus	269	3.30%	0.40%	8.92%	87.36%	NA
Indica I	595	18.50%	0.30%	5.88%	75.29%	NA
Indica II	465	13.50%	1.30%	3.66%	81.51%	NA
Indica III	913	2.40%	0.40%	3.50%	93.65%	NA
Indica Intermediate	786	16.50%	0.60%	6.74%	76.08%	NA
Temperate Japonica	767	96.30%	3.30%	0.00%	0.39%	NA
Tropical Japonica	504	16.30%	81.30%	0.40%	1.98%	NA
Japonica Intermediate	241	72.60%	25.30%	0.00%	2.07%	NA
VI/Aromatic	96	55.20%	6.20%	4.17%	34.38%	NA
Intermediate	90	41.10%	20.00%	1.11%	37.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0407789423	G -> C	LOC_Os04g13940.1	upstream_gene_variant ; 803.0bp to feature; MODIFIER	silent_mutation	Average:11.465; most accessible tissue: Zhenshan97 panicle, score: 24.575	N	N	N	N
vg0407789423	G -> C	LOC_Os04g13950.1	upstream_gene_variant ; 4584.0bp to feature; MODIFIER	silent_mutation	Average:11.465; most accessible tissue: Zhenshan97 panicle, score: 24.575	N	N	N	N
vg0407789423	G -> C	LOC_Os04g13930.1	downstream_gene_variant ; 2837.0bp to feature; MODIFIER	silent_mutation	Average:11.465; most accessible tissue: Zhenshan97 panicle, score: 24.575	N	N	N	N
vg0407789423	G -> C	LOC_Os04g13930-LOC_Os04g13940	intergenic_region ; MODIFIER	silent_mutation	Average:11.465; most accessible tissue: Zhenshan97 panicle, score: 24.575	N	N	N	N
vg0407789423	G -> DEL	N	N	silent_mutation	Average:11.465; most accessible tissue: Zhenshan97 panicle, score: 24.575	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0407789423	NA	2.85E-06	mr1047	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407789423	NA	6.75E-21	mr1301	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407789423	NA	5.82E-14	mr1301	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407789423	NA	3.19E-07	mr1338	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407789423	NA	8.42E-14	mr1410	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407789423	NA	2.84E-12	mr1454	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407789423	NA	1.42E-10	mr1454	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407789423	NA	2.63E-06	mr1471	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407789423	NA	2.34E-08	mr1539	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407789423	NA	3.15E-12	mr1540	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407789423	NA	7.33E-13	mr1732	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407789423	NA	7.88E-24	mr1301_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407789423	NA	2.69E-16	mr1301_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407789423	NA	1.12E-15	mr1410_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407789423	NA	8.97E-13	mr1993_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251