\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0407785574:

Variant ID: vg0407785574 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 7785574
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.90, G: 0.10, others allele: 0.00, population size: 69. )

Flanking Sequence (100 bp) in Reference Genome:


ACCACTACAAGTGCCAGAATGGAAATGGGATGAAATTGGGATGGATTTTATCACCGAACTTCCAAAAACCCAAGGCGGATATGATTCTATATGGGTAGTC[A/G]
TGGATCGACTAACCAAGGTAGCACGGTTCATTCCTGTAAAGACCACCTATGGAGGGAACAAACTAGCTGAACTCTACTTCGCTAGGATCGTAAGTCTGCA

Reverse complement sequence

TGCAGACTTACGATCCTAGCGAAGTAGAGTTCAGCTAGTTTGTTCCCTCCATAGGTGGTCTTTACAGGAATGAACCGTGCTACCTTGGTTAGTCGATCCA[T/C]
GACTACCCATATAGAATCATATCCGCCTTGGGTTTTTGGAAGTTCGGTGATAAAATCCATCCCAATTTCATCCCATTTCCATTCTGGCACTTGTAGTGGT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 37.90% 5.20% 35.34% 21.65% NA
All Indica  2759 19.80% 6.00% 53.28% 20.95% NA
All Japonica  1512 74.80% 4.90% 7.34% 12.96% NA
Aus  269 4.80% 0.00% 12.64% 82.53% NA
Indica I  595 19.00% 1.70% 28.07% 51.26% NA
Indica II  465 17.20% 5.60% 72.04% 5.16% NA
Indica III  913 20.40% 9.10% 59.69% 10.84% NA
Indica Intermediate  786 21.20% 5.90% 53.82% 19.08% NA
Temperate Japonica  767 96.30% 0.00% 0.65% 3.00% NA
Tropical Japonica  504 40.70% 13.70% 17.86% 27.78% NA
Japonica Intermediate  241 77.60% 2.10% 6.64% 13.69% NA
VI/Aromatic  96 56.20% 3.10% 27.08% 13.54% NA
Intermediate  90 50.00% 2.20% 32.22% 15.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0407785574 A -> DEL LOC_Os04g13930.1 N frameshift_variant Average:14.334; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg0407785574 A -> G LOC_Os04g13930.1 missense_variant ; p.Met1362Val; MODERATE nonsynonymous_codon ; M1362V Average:14.334; most accessible tissue: Minghui63 panicle, score: 20.733 benign -0.969 TOLERATED 1.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0407785574 NA 8.63E-08 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407785574 NA 4.96E-06 mr1047 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407785574 NA 1.18E-27 mr1072 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407785574 NA 6.93E-10 mr1162 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407785574 NA 4.03E-06 mr1285 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407785574 NA 6.46E-06 mr1446 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407785574 NA 4.47E-12 mr1471 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407785574 NA 4.70E-08 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407785574 NA 5.91E-06 mr1553 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407785574 NA 3.74E-11 mr1630 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407785574 NA 2.01E-06 mr1642 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407785574 NA 2.31E-10 mr1663 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407785574 NA 1.58E-06 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407785574 NA 3.39E-08 mr1770 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407785574 NA 5.92E-10 mr1790 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407785574 NA 3.29E-06 mr1790 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407785574 NA 3.35E-07 mr1805 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407785574 NA 4.15E-07 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407785574 9.75E-08 NA mr1891 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251