| Variant ID: vg0407691066 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 7691066 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 80. )
CAATATATTTGTTACAATAATAATATTCCACTAGTATTAGGTATACTAACCTTTTGCAGCGAATGACAATAAAGTGGAGGAGAATCGACATCAACTCGGA[C/T]
GATAAATCAATTGGACGGTGTCGAGAACCAGACTTATGTATGAATGGGCCAAGAACTCAGAAATAACACGACACATTGGGCCAAAATTCACAAGTCTATG
CATAGACTTGTGAATTTTGGCCCAATGTGTCGTGTTATTTCTGAGTTCTTGGCCCATTCATACATAAGTCTGGTTCTCGACACCGTCCAATTGATTTATC[G/A]
TCCGAGTTGATGTCGATTCTCCTCCACTTTATTGTCATTCGCTGCAAAAGGTTAGTATACCTAATACTAGTGGAATATTATTATTGTAACAAATATATTG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 49.60% | 0.10% | 1.21% | 49.11% | NA |
| All Indica | 2759 | 24.50% | 0.10% | 1.81% | 73.58% | NA |
| All Japonica | 1512 | 98.40% | 0.00% | 0.07% | 1.52% | NA |
| Aus | 269 | 20.80% | 0.00% | 1.86% | 77.32% | NA |
| Indica I | 595 | 51.60% | 0.00% | 1.68% | 46.72% | NA |
| Indica II | 465 | 24.90% | 0.00% | 1.51% | 73.55% | NA |
| Indica III | 913 | 3.60% | 0.00% | 2.30% | 94.09% | NA |
| Indica Intermediate | 786 | 28.00% | 0.40% | 1.53% | 70.10% | NA |
| Temperate Japonica | 767 | 98.40% | 0.00% | 0.13% | 1.43% | NA |
| Tropical Japonica | 504 | 98.60% | 0.00% | 0.00% | 1.39% | NA |
| Japonica Intermediate | 241 | 97.90% | 0.00% | 0.00% | 2.07% | NA |
| VI/Aromatic | 96 | 66.70% | 0.00% | 0.00% | 33.33% | NA |
| Intermediate | 90 | 65.60% | 2.20% | 1.11% | 31.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0407691066 | C -> DEL | N | N | silent_mutation | Average:14.227; most accessible tissue: Callus, score: 20.741 | N | N | N | N |
| vg0407691066 | C -> T | LOC_Os04g13790.1 | upstream_gene_variant ; 1500.0bp to feature; MODIFIER | silent_mutation | Average:14.227; most accessible tissue: Callus, score: 20.741 | N | N | N | N |
| vg0407691066 | C -> T | LOC_Os04g13800.1 | upstream_gene_variant ; 4520.0bp to feature; MODIFIER | silent_mutation | Average:14.227; most accessible tissue: Callus, score: 20.741 | N | N | N | N |
| vg0407691066 | C -> T | LOC_Os04g13780-LOC_Os04g13790 | intergenic_region ; MODIFIER | silent_mutation | Average:14.227; most accessible tissue: Callus, score: 20.741 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0407691066 | NA | 1.97E-09 | mr1299 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407691066 | NA | 3.90E-16 | mr1362 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407691066 | NA | 1.50E-13 | mr1655 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407691066 | NA | 2.64E-07 | mr1836 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407691066 | NA | 2.93E-07 | mr1915 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407691066 | NA | 5.37E-16 | mr1836_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |