Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0407691066:

Variant ID: vg0407691066 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 7691066
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:

CAATATATTTGTTACAATAATAATATTCCACTAGTATTAGGTATACTAACCTTTTGCAGCGAATGACAATAAAGTGGAGGAGAATCGACATCAACTCGGA[C/T]
GATAAATCAATTGGACGGTGTCGAGAACCAGACTTATGTATGAATGGGCCAAGAACTCAGAAATAACACGACACATTGGGCCAAAATTCACAAGTCTATG

Reverse complement sequence

CATAGACTTGTGAATTTTGGCCCAATGTGTCGTGTTATTTCTGAGTTCTTGGCCCATTCATACATAAGTCTGGTTCTCGACACCGTCCAATTGATTTATC[G/A]
TCCGAGTTGATGTCGATTCTCCTCCACTTTATTGTCATTCGCTGCAAAAGGTTAGTATACCTAATACTAGTGGAATATTATTATTGTAACAAATATATTG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	49.60%	0.10%	1.21%	49.11%	NA
All Indica	2759	24.50%	0.10%	1.81%	73.58%	NA
All Japonica	1512	98.40%	0.00%	0.07%	1.52%	NA
Aus	269	20.80%	0.00%	1.86%	77.32%	NA
Indica I	595	51.60%	0.00%	1.68%	46.72%	NA
Indica II	465	24.90%	0.00%	1.51%	73.55%	NA
Indica III	913	3.60%	0.00%	2.30%	94.09%	NA
Indica Intermediate	786	28.00%	0.40%	1.53%	70.10%	NA
Temperate Japonica	767	98.40%	0.00%	0.13%	1.43%	NA
Tropical Japonica	504	98.60%	0.00%	0.00%	1.39%	NA
Japonica Intermediate	241	97.90%	0.00%	0.00%	2.07%	NA
VI/Aromatic	96	66.70%	0.00%	0.00%	33.33%	NA
Intermediate	90	65.60%	2.20%	1.11%	31.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0407691066	C -> DEL	N	N	silent_mutation	Average:14.227; most accessible tissue: Callus, score: 20.741	N	N	N	N
vg0407691066	C -> T	LOC_Os04g13790.1	upstream_gene_variant ; 1500.0bp to feature; MODIFIER	silent_mutation	Average:14.227; most accessible tissue: Callus, score: 20.741	N	N	N	N
vg0407691066	C -> T	LOC_Os04g13800.1	upstream_gene_variant ; 4520.0bp to feature; MODIFIER	silent_mutation	Average:14.227; most accessible tissue: Callus, score: 20.741	N	N	N	N
vg0407691066	C -> T	LOC_Os04g13780-LOC_Os04g13790	intergenic_region ; MODIFIER	silent_mutation	Average:14.227; most accessible tissue: Callus, score: 20.741	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0407691066	NA	1.97E-09	mr1299	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407691066	NA	3.90E-16	mr1362	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407691066	NA	1.50E-13	mr1655	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407691066	NA	2.64E-07	mr1836	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407691066	NA	2.93E-07	mr1915	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407691066	NA	5.37E-16	mr1836_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251