\
| Variant ID: vg0407668419 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 7668419 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 113. )
AGGATGTTAAGTGATAAAGTATCAGAATGTTTAGCTGATTACAAAAGTTCTAAGTCCTATTACATTAAGATTACTGTGATAAGTATTGCTGGATAGCCGA[T/C]
ATAGCTTTCTGCCTAATATGCTCTACTTCCTCTATGGCTTGAGCATCTTGAGCATCGGTTCCAGGAATAACTTTTAAGGACTTGGTCAGTTCAGCAACAT
ATGTTGCTGAACTGACCAAGTCCTTAAAAGTTATTCCTGGAACCGATGCTCAAGATGCTCAAGCCATAGAGGAAGTAGAGCATATTAGGCAGAAAGCTAT[A/G]
TCGGCTATCCAGCAATACTTATCACAGTAATCTTAATGTAATAGGACTTAGAACTTTTGTAATCAGCTAAACATTCTGATACTTTATCACTTAACATCCT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 82.00% | 2.00% | 9.33% | 6.69% | NA |
| All Indica | 2759 | 73.00% | 3.40% | 14.43% | 9.13% | NA |
| All Japonica | 1512 | 99.30% | 0.00% | 0.26% | 0.40% | NA |
| Aus | 269 | 71.70% | 0.00% | 10.04% | 18.22% | NA |
| Indica I | 595 | 82.20% | 1.30% | 8.24% | 8.24% | NA |
| Indica II | 465 | 68.20% | 7.50% | 16.99% | 7.31% | NA |
| Indica III | 913 | 69.90% | 2.70% | 16.32% | 11.06% | NA |
| Indica Intermediate | 786 | 72.50% | 3.40% | 15.39% | 8.65% | NA |
| Temperate Japonica | 767 | 99.70% | 0.00% | 0.13% | 0.13% | NA |
| Tropical Japonica | 504 | 99.00% | 0.00% | 0.60% | 0.40% | NA |
| Japonica Intermediate | 241 | 98.80% | 0.00% | 0.00% | 1.24% | NA |
| VI/Aromatic | 96 | 94.80% | 0.00% | 2.08% | 3.12% | NA |
| Intermediate | 90 | 81.10% | 1.10% | 11.11% | 6.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0407668419 | T -> C | LOC_Os04g13750.1 | 3_prime_UTR_variant ; 628.0bp to feature; MODIFIER | silent_mutation | Average:7.957; most accessible tissue: Callus, score: 23.614 | N | N | N | N |
| vg0407668419 | T -> C | LOC_Os04g13740.1 | downstream_gene_variant ; 1031.0bp to feature; MODIFIER | silent_mutation | Average:7.957; most accessible tissue: Callus, score: 23.614 | N | N | N | N |
| vg0407668419 | T -> DEL | N | N | silent_mutation | Average:7.957; most accessible tissue: Callus, score: 23.614 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0407668419 | NA | 5.40E-07 | mr1053 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407668419 | NA | 1.75E-07 | mr1027_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407668419 | NA | 1.35E-07 | mr1045_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407668419 | 3.11E-06 | 4.63E-10 | mr1053_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407668419 | NA | 2.16E-06 | mr1053_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407668419 | 9.97E-06 | NA | mr1147_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407668419 | NA | 7.86E-06 | mr1204_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407668419 | NA | 6.50E-06 | mr1204_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407668419 | 3.87E-06 | 7.06E-08 | mr1250_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |