Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0407565723:

Variant ID: vg0407565723 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 7565723
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.90, T: 0.10, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:

ATGTAGACCTCTATGAGATGGGCGAGATGCTCGCTGCCTAGGTTATGACCAGTGCGGCCAATTTGTATGACTCCATCGGGTAATCATCTCAAAATGTAGA[C/T]
CACTTGATGATGGACGAGATACTCGCTGCCTAGGTTATGGTCGATTATGACCAAAGTATAGGTCTCCATCTACATGTGATTAATTTTCGAGTCAAAATGT

Reverse complement sequence

ACATTTTGACTCGAAAATTAATCACATGTAGATGGAGACCTATACTTTGGTCATAATCGACCATAACCTAGGCAGCGAGTATCTCGTCCATCATCAAGTG[G/A]
TCTACATTTTGAGATGATTACCCGATGGAGTCATACAAATTGGCCGCACTGGTCATAACCTAGGCAGCGAGCATCTCGCCCATCTCATAGAGGTCTACAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	26.40%	12.30%	0.53%	60.79%	NA
All Indica	2759	6.50%	1.80%	0.83%	90.83%	NA
All Japonica	1512	65.10%	33.50%	0.00%	1.39%	NA
Aus	269	0.40%	0.40%	0.37%	98.88%	NA
Indica I	595	2.40%	0.20%	1.51%	95.97%	NA
Indica II	465	22.80%	2.40%	1.08%	73.76%	NA
Indica III	913	2.00%	2.70%	0.44%	94.85%	NA
Indica Intermediate	786	5.20%	1.80%	0.64%	92.37%	NA
Temperate Japonica	767	96.10%	3.40%	0.00%	0.52%	NA
Tropical Japonica	504	14.90%	82.50%	0.00%	2.58%	NA
Japonica Intermediate	241	71.80%	26.60%	0.00%	1.66%	NA
VI/Aromatic	96	47.90%	6.20%	1.04%	44.79%	NA
Intermediate	90	40.00%	18.90%	0.00%	41.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0407565723	C -> DEL	N	N	silent_mutation	Average:9.427; most accessible tissue: Callus, score: 26.359	N	N	N	N
vg0407565723	C -> T	LOC_Os04g13550.1	intron_variant ; MODIFIER	silent_mutation	Average:9.427; most accessible tissue: Callus, score: 26.359	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0407565723	8.27E-07	NA	mr1071	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407565723	2.54E-06	NA	mr1140	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407565723	NA	3.41E-23	mr1301	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407565723	NA	3.35E-15	mr1301	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407565723	NA	3.16E-15	mr1410	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407565723	NA	3.21E-11	mr1410	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407565723	NA	7.68E-13	mr1449	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407565723	NA	9.31E-06	mr1502	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407565723	NA	7.62E-09	mr1648	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407565723	NA	2.85E-28	mr1699	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407565723	NA	6.12E-07	mr1739	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407565723	NA	2.26E-06	mr1993	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407565723	NA	7.45E-08	mr1993	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407565723	7.45E-11	NA	mr1071_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407565723	6.77E-12	NA	mr1080_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407565723	5.65E-09	NA	mr1100_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407565723	6.31E-13	NA	mr1203_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407565723	4.65E-06	2.09E-25	mr1301_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407565723	NA	1.24E-18	mr1301_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407565723	NA	9.00E-16	mr1410_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407565723	NA	4.90E-06	mr1510_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407565723	2.51E-15	NA	mr1613_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407565723	1.98E-12	NA	mr1619_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407565723	5.08E-06	NA	mr1795_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407565723	4.00E-08	NA	mr1962_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407565723	NA	3.76E-11	mr1993_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407565723	NA	2.90E-12	mr1993_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251