Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0407338349:

Variant ID: vg0407338349 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 7338349
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 327. )

Flanking Sequence (100 bp) in Reference Genome:

GAACAGACGGAAGCAATGGGGAAGCAAAAGGATGCTGGAAAAGCTAATCTAGTTGCTAAAATTAATATCTTAGAGAAGGAAAGATGTATGCATTAGTAGC[A/G]
TGTGTATTTATAATTCTGGGGTTGTATGTTAAGCTGTGATCTTTCTGTATATGCAGTATACTAACATGTAATCACTGCATGCATGTAACATGTTTCTCAA

Reverse complement sequence

TTGAGAAACATGTTACATGCATGCAGTGATTACATGTTAGTATACTGCATATACAGAAAGATCACAGCTTAACATACAACCCCAGAATTATAAATACACA[T/C]
GCTACTAATGCATACATCTTTCCTTCTCTAAGATATTAATTTTAGCAACTAGATTAGCTTTTCCAGCATCCTTTTGCTTCCCCATTGCTTCCGTCTGTTC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.00%	9.90%	0.23%	0.83%	NA
All Indica	2759	99.50%	0.40%	0.04%	0.00%	NA
All Japonica	1512	67.70%	29.20%	0.53%	2.58%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	98.70%	1.30%	0.00%	0.00%	NA
Indica III	913	99.80%	0.20%	0.00%	0.00%	NA
Indica Intermediate	786	99.40%	0.50%	0.13%	0.00%	NA
Temperate Japonica	767	97.30%	2.60%	0.13%	0.00%	NA
Tropical Japonica	504	19.80%	71.60%	1.19%	7.34%	NA
Japonica Intermediate	241	73.90%	24.90%	0.41%	0.83%	NA
VI/Aromatic	96	93.80%	6.20%	0.00%	0.00%	NA
Intermediate	90	85.60%	12.20%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0407338349	A -> DEL	N	N	silent_mutation	Average:71.913; most accessible tissue: Minghui63 flag leaf, score: 84.028	N	N	N	N
vg0407338349	A -> G	LOC_Os04g13240.1	upstream_gene_variant ; 3045.0bp to feature; MODIFIER	silent_mutation	Average:71.913; most accessible tissue: Minghui63 flag leaf, score: 84.028	N	N	N	N
vg0407338349	A -> G	LOC_Os04g13250.1	upstream_gene_variant ; 4789.0bp to feature; MODIFIER	silent_mutation	Average:71.913; most accessible tissue: Minghui63 flag leaf, score: 84.028	N	N	N	N
vg0407338349	A -> G	LOC_Os04g13240-LOC_Os04g13250	intergenic_region ; MODIFIER	silent_mutation	Average:71.913; most accessible tissue: Minghui63 flag leaf, score: 84.028	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0407338349	NA	1.24E-07	mr1194	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407338349	NA	8.64E-06	mr1271	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407338349	NA	1.27E-08	mr1271	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407338349	NA	4.15E-21	mr1301	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407338349	NA	7.71E-06	mr1359	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407338349	NA	7.35E-07	mr1403	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407338349	NA	9.47E-14	mr1410	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407338349	NA	3.81E-14	mr1449	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407338349	NA	3.39E-09	mr1449	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407338349	NA	2.70E-14	mr1454	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407338349	8.39E-06	1.18E-13	mr1454	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407338349	NA	1.40E-06	mr1527	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407338349	NA	1.57E-08	mr1539	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407338349	NA	1.23E-11	mr1540	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407338349	NA	4.27E-14	mr1540	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407338349	NA	1.03E-07	mr1668	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407338349	NA	2.87E-35	mr1699	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407338349	NA	1.02E-16	mr1699	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407338349	NA	1.10E-18	mr1715	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407338349	NA	9.75E-07	mr1739	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407338349	NA	2.14E-11	mr1864	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407338349	NA	2.02E-10	mr1880	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407338349	NA	1.93E-24	mr1301_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407338349	NA	1.73E-15	mr1301_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407338349	NA	4.29E-15	mr1410_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407338349	NA	2.71E-10	mr1905_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407338349	NA	5.48E-11	mr1993_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251