\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0407142823:

Variant ID: vg0407142823 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 7142823
Reference Allele: GAlternative Allele: T
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.70, T: 0.30, others allele: 0.00, population size: 191. )

Flanking Sequence (100 bp) in Reference Genome:


TCCTACCCTACTGCATAGGGAAAGCTCAAGTGTGATGTGGATGATGTATAGGGATTGATGAATAATGTGTTGCTGTGGTTCATACTTTGTTTGTTCAAAA[G/T]
ATATAATTTATAATGCACTTATCTACGAGATGCATGGATAACATGTGTTGGATCTGATAAAATAGGTCAAGTATATATTGTCCATGAGCAAGTGAGCCTT

Reverse complement sequence

AAGGCTCACTTGCTCATGGACAATATATACTTGACCTATTTTATCAGATCCAACACATGTTATCCATGCATCTCGTAGATAAGTGCATTATAAATTATAT[C/A]
TTTTGAACAAACAAAGTATGAACCACAGCAACACATTATTCATCAATCCCTATACATCATCCACATCACACTTGAGCTTTCCCTATGCAGTAGGGTAGGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.50% 28.70% 13.82% 5.06% NA
All Indica  2759 60.70% 12.40% 22.36% 4.46% NA
All Japonica  1512 37.60% 62.30% 0.00% 0.07% NA
Aus  269 48.30% 1.10% 10.41% 40.15% NA
Indica I  595 60.70% 5.70% 30.59% 3.03% NA
Indica II  465 75.90% 13.10% 9.46% 1.51% NA
Indica III  913 53.20% 11.20% 28.26% 7.34% NA
Indica Intermediate  786 60.60% 18.60% 16.92% 3.94% NA
Temperate Japonica  767 2.70% 97.30% 0.00% 0.00% NA
Tropical Japonica  504 91.50% 8.30% 0.00% 0.20% NA
Japonica Intermediate  241 36.10% 63.90% 0.00% 0.00% NA
VI/Aromatic  96 59.40% 33.30% 2.08% 5.21% NA
Intermediate  90 52.20% 38.90% 6.67% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0407142823 G -> DEL N N silent_mutation Average:47.352; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg0407142823 G -> T LOC_Os04g12920-LOC_Os04g12950 intergenic_region ; MODIFIER silent_mutation Average:47.352; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0407142823 NA 4.89E-06 mr1087 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407142823 NA 3.07E-09 mr1089 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407142823 NA 6.99E-07 mr1157 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407142823 NA 4.12E-07 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407142823 NA 6.76E-09 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407142823 NA 1.40E-06 mr1285 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407142823 NA 3.79E-07 mr1291 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407142823 NA 2.32E-06 mr1378 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407142823 NA 5.33E-06 mr1427 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407142823 NA 1.41E-09 mr1449 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407142823 NA 2.63E-11 mr1454 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407142823 NA 4.37E-11 mr1471 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407142823 NA 1.79E-06 mr1515 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407142823 NA 7.77E-06 mr1576 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407142823 NA 2.07E-10 mr1630 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407142823 NA 2.48E-06 mr1649 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407142823 4.65E-07 NA mr1687 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407142823 6.02E-07 6.02E-07 mr1687 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407142823 NA 1.43E-06 mr1704 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407142823 NA 4.88E-12 mr1741 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407142823 NA 4.64E-09 mr1746 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407142823 NA 3.21E-07 mr1785 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407142823 NA 5.08E-08 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407142823 NA 1.55E-13 mr1844 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407142823 NA 5.39E-06 mr1844 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407142823 NA 5.95E-06 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251