Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0407142823:

Variant ID: vg0407142823 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 7142823
Reference Allele: G	Alternative Allele: T
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.70, T: 0.30, others allele: 0.00, population size: 191. )

Flanking Sequence (100 bp) in Reference Genome:

TCCTACCCTACTGCATAGGGAAAGCTCAAGTGTGATGTGGATGATGTATAGGGATTGATGAATAATGTGTTGCTGTGGTTCATACTTTGTTTGTTCAAAA[G/T]
ATATAATTTATAATGCACTTATCTACGAGATGCATGGATAACATGTGTTGGATCTGATAAAATAGGTCAAGTATATATTGTCCATGAGCAAGTGAGCCTT

Reverse complement sequence

AAGGCTCACTTGCTCATGGACAATATATACTTGACCTATTTTATCAGATCCAACACATGTTATCCATGCATCTCGTAGATAAGTGCATTATAAATTATAT[C/A]
TTTTGAACAAACAAAGTATGAACCACAGCAACACATTATTCATCAATCCCTATACATCATCCACATCACACTTGAGCTTTCCCTATGCAGTAGGGTAGGA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.50%	28.70%	13.82%	5.06%	NA
All Indica	2759	60.70%	12.40%	22.36%	4.46%	NA
All Japonica	1512	37.60%	62.30%	0.00%	0.07%	NA
Aus	269	48.30%	1.10%	10.41%	40.15%	NA
Indica I	595	60.70%	5.70%	30.59%	3.03%	NA
Indica II	465	75.90%	13.10%	9.46%	1.51%	NA
Indica III	913	53.20%	11.20%	28.26%	7.34%	NA
Indica Intermediate	786	60.60%	18.60%	16.92%	3.94%	NA
Temperate Japonica	767	2.70%	97.30%	0.00%	0.00%	NA
Tropical Japonica	504	91.50%	8.30%	0.00%	0.20%	NA
Japonica Intermediate	241	36.10%	63.90%	0.00%	0.00%	NA
VI/Aromatic	96	59.40%	33.30%	2.08%	5.21%	NA
Intermediate	90	52.20%	38.90%	6.67%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0407142823	G -> DEL	N	N	silent_mutation	Average:47.352; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N
vg0407142823	G -> T	LOC_Os04g12920-LOC_Os04g12950	intergenic_region ; MODIFIER	silent_mutation	Average:47.352; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0407142823	NA	4.89E-06	mr1087	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407142823	NA	3.07E-09	mr1089	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407142823	NA	6.99E-07	mr1157	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407142823	NA	4.12E-07	mr1229	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407142823	NA	6.76E-09	mr1252	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407142823	NA	1.40E-06	mr1285	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407142823	NA	3.79E-07	mr1291	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407142823	NA	2.32E-06	mr1378	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407142823	NA	5.33E-06	mr1427	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407142823	NA	1.41E-09	mr1449	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407142823	NA	2.63E-11	mr1454	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407142823	NA	4.37E-11	mr1471	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407142823	NA	1.79E-06	mr1515	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407142823	NA	7.77E-06	mr1576	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407142823	NA	2.07E-10	mr1630	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407142823	NA	2.48E-06	mr1649	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407142823	4.65E-07	NA	mr1687	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407142823	6.02E-07	6.02E-07	mr1687	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407142823	NA	1.43E-06	mr1704	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407142823	NA	4.88E-12	mr1741	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407142823	NA	4.64E-09	mr1746	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407142823	NA	3.21E-07	mr1785	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407142823	NA	5.08E-08	mr1815	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407142823	NA	1.55E-13	mr1844	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407142823	NA	5.39E-06	mr1844	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407142823	NA	5.95E-06	mr1211_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251