\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0407140848:

Variant ID: vg0407140848 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 7140848
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, C: 0.01, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


GTAGAGTTAAAAGTACTCTAGTAATTTGGTTGGGAGTAACGTTAATCTGGTTAATTTCGATTAAGAGCAACCAAAATACTGTATTTTCTCTCTGTAAAAA[A/C]
ACTCCAAAAATACATTTTTTTTAATTTGAGAAACAACATTACAAACGTAGATACTCACAATACACATACACCCATATAAACGCACATATACACCCAACCT

Reverse complement sequence

AGGTTGGGTGTATATGTGCGTTTATATGGGTGTATGTGTATTGTGAGTATCTACGTTTGTAATGTTGTTTCTCAAATTAAAAAAAATGTATTTTTGGAGT[T/G]
TTTTTACAGAGAGAAAATACAGTATTTTGGTTGCTCTTAATCGAAATTAACCAGATTAACGTTACTCCCAACCAAATTACTAGAGTACTTTTAACTCTAC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 37.60% 22.10% 1.61% 38.64% NA
All Indica  2759 21.30% 30.90% 1.45% 46.32% NA
All Japonica  1512 65.10% 1.10% 0.20% 33.66% NA
Aus  269 46.50% 42.40% 10.78% 0.37% NA
Indica I  595 6.10% 20.20% 2.02% 71.76% NA
Indica II  465 15.30% 41.30% 0.86% 42.58% NA
Indica III  913 32.10% 31.00% 0.66% 36.25% NA
Indica Intermediate  786 24.00% 32.70% 2.29% 40.97% NA
Temperate Japonica  767 98.00% 0.30% 0.00% 1.69% NA
Tropical Japonica  504 11.90% 1.60% 0.60% 85.91% NA
Japonica Intermediate  241 71.40% 2.50% 0.00% 26.14% NA
VI/Aromatic  96 42.70% 40.60% 2.08% 14.58% NA
Intermediate  90 43.30% 27.80% 2.22% 26.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0407140848 A -> C LOC_Os04g12920.1 upstream_gene_variant ; 3197.0bp to feature; MODIFIER silent_mutation Average:44.733; most accessible tissue: Zhenshan97 flower, score: 75.428 N N N N
vg0407140848 A -> C LOC_Os04g12920-LOC_Os04g12950 intergenic_region ; MODIFIER silent_mutation Average:44.733; most accessible tissue: Zhenshan97 flower, score: 75.428 N N N N
vg0407140848 A -> DEL N N silent_mutation Average:44.733; most accessible tissue: Zhenshan97 flower, score: 75.428 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0407140848 NA 1.06E-06 mr1071 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407140848 NA 3.31E-06 mr1080 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407140848 NA 6.66E-06 mr1140 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407140848 NA 9.13E-06 mr1166 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407140848 4.24E-06 7.26E-08 mr1203 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407140848 NA 1.66E-06 mr1285 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407140848 NA 3.20E-06 mr1286 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407140848 NA 1.21E-11 mr1299 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407140848 NA 6.65E-07 mr1395 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407140848 NA 1.59E-06 mr1515 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407140848 NA 2.45E-27 mr1537 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407140848 NA 4.95E-18 mr1566 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407140848 NA 6.56E-06 mr1613 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407140848 NA 1.83E-06 mr1618 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407140848 NA 8.25E-06 mr1619 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407140848 NA 2.35E-12 mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407140848 NA 3.45E-10 mr1630 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407140848 NA 9.63E-10 mr1637 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407140848 NA 4.02E-07 mr1649 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407140848 NA 1.02E-12 mr1655 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407140848 8.78E-07 NA mr1665 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407140848 NA 3.05E-06 mr1665 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407140848 NA 5.88E-19 mr1700 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407140848 NA 4.77E-06 mr1727 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407140848 NA 1.69E-08 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407140848 2.57E-06 2.57E-06 mr1777 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407140848 NA 5.70E-14 mr1819 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407140848 NA 2.26E-07 mr1915 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407140848 6.32E-06 4.53E-08 mr1203_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407140848 NA 1.72E-07 mr1613_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251