\
| Variant ID: vg0407068622 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 7068622 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ATTATTACAACTGTTTTAATCTTTCGACTTATGTTTATAAATGCTCGCTTTATGCAAATGAACCACTCTAGCTCTTCTTGATAATTCCGTGCATCATACC[C/T]
CTATTCCGGTATGACTTGCTGAGTACAGTGGGTAGTATTCAGTCTTGCTCTACTTTTCCCAACCCCAGAGCTCGAGTTTGTGTCAGATGAAGGTTTCTCC
GGAGAAACCTTCATCTGACACAAACTCGAGCTCTGGGGTTGGGAAAAGTAGAGCAAGACTGAATACTACCCACTGTACTCAGCAAGTCATACCGGAATAG[G/A]
GGTATGATGCACGGAATTATCAAGAAGAGCTAGAGTGGTTCATTTGCATAAAGCGAGCATTTATAAACATAAGTCGAAAGATTAAAACAGTTGTAATAAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 78.80% | 5.70% | 4.89% | 10.60% | NA |
| All Indica | 2759 | 82.20% | 0.40% | 3.91% | 13.56% | NA |
| All Japonica | 1512 | 69.30% | 16.60% | 6.88% | 7.21% | NA |
| Aus | 269 | 95.50% | 0.00% | 1.86% | 2.60% | NA |
| Indica I | 595 | 71.80% | 0.00% | 5.88% | 22.35% | NA |
| Indica II | 465 | 85.40% | 0.20% | 2.37% | 12.04% | NA |
| Indica III | 913 | 86.40% | 0.70% | 2.96% | 9.97% | NA |
| Indica Intermediate | 786 | 83.20% | 0.40% | 4.45% | 11.96% | NA |
| Temperate Japonica | 767 | 98.20% | 0.40% | 0.39% | 1.04% | NA |
| Tropical Japonica | 504 | 21.80% | 45.80% | 18.06% | 14.29% | NA |
| Japonica Intermediate | 241 | 76.80% | 7.10% | 4.15% | 12.03% | NA |
| VI/Aromatic | 96 | 86.50% | 1.00% | 9.38% | 3.12% | NA |
| Intermediate | 90 | 77.80% | 7.80% | 5.56% | 8.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0407068622 | C -> DEL | N | N | silent_mutation | Average:28.658; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
| vg0407068622 | C -> T | LOC_Os04g12770.1 | upstream_gene_variant ; 1461.0bp to feature; MODIFIER | silent_mutation | Average:28.658; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
| vg0407068622 | C -> T | LOC_Os04g12780.1 | downstream_gene_variant ; 321.0bp to feature; MODIFIER | silent_mutation | Average:28.658; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
| vg0407068622 | C -> T | LOC_Os04g12770-LOC_Os04g12780 | intergenic_region ; MODIFIER | silent_mutation | Average:28.658; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0407068622 | NA | 3.80E-06 | mr1129_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407068622 | NA | 3.70E-07 | mr1194_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407068622 | NA | 8.86E-07 | mr1248_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407068622 | NA | 3.89E-06 | mr1253_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407068622 | NA | 2.66E-06 | mr1255_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407068622 | NA | 1.13E-06 | mr1295_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407068622 | 3.32E-06 | NA | mr1301_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407068622 | NA | 4.01E-06 | mr1736_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407068622 | 4.94E-06 | 4.53E-07 | mr1781_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |