\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0407068622:

Variant ID: vg0407068622 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 7068622
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATTATTACAACTGTTTTAATCTTTCGACTTATGTTTATAAATGCTCGCTTTATGCAAATGAACCACTCTAGCTCTTCTTGATAATTCCGTGCATCATACC[C/T]
CTATTCCGGTATGACTTGCTGAGTACAGTGGGTAGTATTCAGTCTTGCTCTACTTTTCCCAACCCCAGAGCTCGAGTTTGTGTCAGATGAAGGTTTCTCC

Reverse complement sequence

GGAGAAACCTTCATCTGACACAAACTCGAGCTCTGGGGTTGGGAAAAGTAGAGCAAGACTGAATACTACCCACTGTACTCAGCAAGTCATACCGGAATAG[G/A]
GGTATGATGCACGGAATTATCAAGAAGAGCTAGAGTGGTTCATTTGCATAAAGCGAGCATTTATAAACATAAGTCGAAAGATTAAAACAGTTGTAATAAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.80% 5.70% 4.89% 10.60% NA
All Indica  2759 82.20% 0.40% 3.91% 13.56% NA
All Japonica  1512 69.30% 16.60% 6.88% 7.21% NA
Aus  269 95.50% 0.00% 1.86% 2.60% NA
Indica I  595 71.80% 0.00% 5.88% 22.35% NA
Indica II  465 85.40% 0.20% 2.37% 12.04% NA
Indica III  913 86.40% 0.70% 2.96% 9.97% NA
Indica Intermediate  786 83.20% 0.40% 4.45% 11.96% NA
Temperate Japonica  767 98.20% 0.40% 0.39% 1.04% NA
Tropical Japonica  504 21.80% 45.80% 18.06% 14.29% NA
Japonica Intermediate  241 76.80% 7.10% 4.15% 12.03% NA
VI/Aromatic  96 86.50% 1.00% 9.38% 3.12% NA
Intermediate  90 77.80% 7.80% 5.56% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0407068622 C -> DEL N N silent_mutation Average:28.658; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N
vg0407068622 C -> T LOC_Os04g12770.1 upstream_gene_variant ; 1461.0bp to feature; MODIFIER silent_mutation Average:28.658; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N
vg0407068622 C -> T LOC_Os04g12780.1 downstream_gene_variant ; 321.0bp to feature; MODIFIER silent_mutation Average:28.658; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N
vg0407068622 C -> T LOC_Os04g12770-LOC_Os04g12780 intergenic_region ; MODIFIER silent_mutation Average:28.658; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0407068622 NA 3.80E-06 mr1129_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407068622 NA 3.70E-07 mr1194_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407068622 NA 8.86E-07 mr1248_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407068622 NA 3.89E-06 mr1253_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407068622 NA 2.66E-06 mr1255_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407068622 NA 1.13E-06 mr1295_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407068622 3.32E-06 NA mr1301_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407068622 NA 4.01E-06 mr1736_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0407068622 4.94E-06 4.53E-07 mr1781_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251