| Variant ID: vg0407001583 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 7001583 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TCGGTCATCAATTCGGTCCAAGGTAGTGAAAGACTGAATTTTGTTCGGTCAATTCGGTTAGTACCCTCGGGTAACCGAATAGACCGAATTATCAAAAAAT[A/G]
TCTAAATGCAACCTACAATCCACTATGTTTAATAGGATTAAACTCTAATTTTCACATCCCTACTTCTTCTAGGCATGCAACCTAATAAGAGTCTTTACTC
GAGTAAAGACTCTTATTAGGTTGCATGCCTAGAAGAAGTAGGGATGTGAAAATTAGAGTTTAATCCTATTAAACATAGTGGATTGTAGGTTGCATTTAGA[T/C]
ATTTTTTGATAATTCGGTCTATTCGGTTACCCGAGGGTACTAACCGAATTGACCGAACAAAATTCAGTCTTTCACTACCTTGGACCGAATTGATGACCGA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 44.10% | 8.90% | 0.72% | 46.32% | NA |
| All Indica | 2759 | 16.20% | 14.90% | 1.09% | 67.81% | NA |
| All Japonica | 1512 | 99.00% | 0.20% | 0.00% | 0.79% | NA |
| Aus | 269 | 5.60% | 0.00% | 1.49% | 92.94% | NA |
| Indica I | 595 | 6.70% | 4.20% | 1.01% | 88.07% | NA |
| Indica II | 465 | 34.00% | 10.30% | 1.08% | 54.62% | NA |
| Indica III | 913 | 15.80% | 21.60% | 1.20% | 61.45% | NA |
| Indica Intermediate | 786 | 13.50% | 17.80% | 1.02% | 67.68% | NA |
| Temperate Japonica | 767 | 99.60% | 0.30% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 98.40% | 0.20% | 0.00% | 1.39% | NA |
| Japonica Intermediate | 241 | 98.30% | 0.00% | 0.00% | 1.66% | NA |
| VI/Aromatic | 96 | 69.80% | 0.00% | 0.00% | 30.21% | NA |
| Intermediate | 90 | 61.10% | 8.90% | 0.00% | 30.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0407001583 | A -> DEL | N | N | silent_mutation | Average:20.882; most accessible tissue: Minghui63 panicle, score: 53.77 | N | N | N | N |
| vg0407001583 | A -> G | LOC_Os04g12639.1 | intron_variant ; MODIFIER | silent_mutation | Average:20.882; most accessible tissue: Minghui63 panicle, score: 53.77 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0407001583 | NA | 5.99E-06 | mr1649 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407001583 | 4.69E-06 | 1.05E-06 | mr1833 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407001583 | 2.36E-06 | 2.37E-06 | mr1966 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0407001583 | 1.17E-06 | 1.17E-06 | mr1966 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |