Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0406987099:

Variant ID: vg0406987099 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 6987099
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, A: 0.08, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:

TGTTCATAGATTTGGTATTCCTCAAACGTTAAAGGAGCTTCTTTTATGTCCAAGGAAGTGAGAAGTTTTGCTGAATCTTATGATATTAGGTTGTTGAGTT[C/A]
TTCTCTTTACTACGCTCAGGCTAATGGATAAGCCGAGTCGAGTAATAAAACATTGTTGAAATTGTCGTTTTGCCAGTTGAGGTAAATCTTGGCTCTCTTT

Reverse complement sequence

AAAGAGAGCCAAGATTTACCTCAACTGGCAAAACGACAATTTCAACAATGTTTTATTACTCGACTCGGCTTATCCATTAGCCTGAGCGTAGTAAAGAGAA[G/T]
AACTCAACAACCTAATATCATAAGATTCAGCAAAACTTCTCACTTCCTTGGACATAAAAGAAGCTCCTTTAACGTTTGAGGAATACCAAATCTATGAACA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	71.00%	10.80%	0.59%	17.67%	NA
All Indica	2759	88.10%	11.60%	0.00%	0.29%	NA
All Japonica	1512	44.80%	0.60%	1.72%	52.84%	NA
Aus	269	40.10%	59.90%	0.00%	0.00%	NA
Indica I	595	95.60%	4.20%	0.00%	0.17%	NA
Indica II	465	89.70%	9.90%	0.00%	0.43%	NA
Indica III	913	88.80%	11.10%	0.00%	0.11%	NA
Indica Intermediate	786	80.50%	19.00%	0.00%	0.51%	NA
Temperate Japonica	767	57.60%	0.50%	1.69%	40.16%	NA
Tropical Japonica	504	14.30%	0.80%	2.18%	82.74%	NA
Japonica Intermediate	241	68.00%	0.40%	0.83%	30.71%	NA
VI/Aromatic	96	76.00%	9.40%	1.04%	13.54%	NA
Intermediate	90	72.20%	10.00%	1.11%	16.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0406987099	C -> DEL	N	N	silent_mutation	Average:23.662; most accessible tissue: Zhenshan97 flag leaf, score: 34.199	N	N	N	N
vg0406987099	C -> A	LOC_Os04g12610.1	intron_variant ; MODIFIER	silent_mutation	Average:23.662; most accessible tissue: Zhenshan97 flag leaf, score: 34.199	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0406987099	NA	2.13E-07	mr1166	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406987099	NA	2.46E-06	mr1286	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406987099	NA	3.24E-06	mr1286	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406987099	NA	4.52E-06	mr1445	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406987099	NA	7.92E-08	mr1665	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406987099	NA	6.05E-06	mr1667	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406987099	7.30E-07	7.30E-07	mr1777	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251