\
| Variant ID: vg0406987099 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 6987099 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, A: 0.08, others allele: 0.00, population size: 254. )
TGTTCATAGATTTGGTATTCCTCAAACGTTAAAGGAGCTTCTTTTATGTCCAAGGAAGTGAGAAGTTTTGCTGAATCTTATGATATTAGGTTGTTGAGTT[C/A]
TTCTCTTTACTACGCTCAGGCTAATGGATAAGCCGAGTCGAGTAATAAAACATTGTTGAAATTGTCGTTTTGCCAGTTGAGGTAAATCTTGGCTCTCTTT
AAAGAGAGCCAAGATTTACCTCAACTGGCAAAACGACAATTTCAACAATGTTTTATTACTCGACTCGGCTTATCCATTAGCCTGAGCGTAGTAAAGAGAA[G/T]
AACTCAACAACCTAATATCATAAGATTCAGCAAAACTTCTCACTTCCTTGGACATAAAAGAAGCTCCTTTAACGTTTGAGGAATACCAAATCTATGAACA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 71.00% | 10.80% | 0.59% | 17.67% | NA |
| All Indica | 2759 | 88.10% | 11.60% | 0.00% | 0.29% | NA |
| All Japonica | 1512 | 44.80% | 0.60% | 1.72% | 52.84% | NA |
| Aus | 269 | 40.10% | 59.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 95.60% | 4.20% | 0.00% | 0.17% | NA |
| Indica II | 465 | 89.70% | 9.90% | 0.00% | 0.43% | NA |
| Indica III | 913 | 88.80% | 11.10% | 0.00% | 0.11% | NA |
| Indica Intermediate | 786 | 80.50% | 19.00% | 0.00% | 0.51% | NA |
| Temperate Japonica | 767 | 57.60% | 0.50% | 1.69% | 40.16% | NA |
| Tropical Japonica | 504 | 14.30% | 0.80% | 2.18% | 82.74% | NA |
| Japonica Intermediate | 241 | 68.00% | 0.40% | 0.83% | 30.71% | NA |
| VI/Aromatic | 96 | 76.00% | 9.40% | 1.04% | 13.54% | NA |
| Intermediate | 90 | 72.20% | 10.00% | 1.11% | 16.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0406987099 | C -> DEL | N | N | silent_mutation | Average:23.662; most accessible tissue: Zhenshan97 flag leaf, score: 34.199 | N | N | N | N |
| vg0406987099 | C -> A | LOC_Os04g12610.1 | intron_variant ; MODIFIER | silent_mutation | Average:23.662; most accessible tissue: Zhenshan97 flag leaf, score: 34.199 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0406987099 | NA | 2.13E-07 | mr1166 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406987099 | NA | 2.46E-06 | mr1286 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406987099 | NA | 3.24E-06 | mr1286 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406987099 | NA | 4.52E-06 | mr1445 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406987099 | NA | 7.92E-08 | mr1665 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406987099 | NA | 6.05E-06 | mr1667 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406987099 | 7.30E-07 | 7.30E-07 | mr1777 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |