Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406960814:

Variant ID: vg0406960814 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 6960814
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.69, G: 0.32, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:

CACTCTTGCTAAACTAGCAAGGTGGTACTAAACGAGCGCACACAACACTCATAGGTCACAAAGGTCTCATCCTAATTGGGCCAGGATATCACACTGGGTC[G/A]
CCGTCAGGTAGGACCACTGTTGGGCCCATCTTCAACCTTCGCAGGCAAAGCCAGAGGGCGTAACCGCCGCCCCGTGCGCCCCGTCCACCTCGCGGCGCCC

Reverse complement sequence

GGGCGCCGCGAGGTGGACGGGGCGCACGGGGCGGCGGTTACGCCCTCTGGCTTTGCCTGCGAAGGTTGAAGATGGGCCCAACAGTGGTCCTACCTGACGG[C/T]
GACCCAGTGTGATATCCTGGCCCAATTAGGATGAGACCTTTGTGACCTATGAGTGTTGTGTGCGCTCGTTTAGTACCACCTTGCTAGTTTAGCAAGAGTG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	72.30%	27.70%	0.02%	0.00%	NA
All Indica	2759	81.50%	18.40%	0.04%	0.00%	NA
All Japonica	1512	64.50%	35.50%	0.00%	0.00%	NA
Aus	269	30.10%	69.90%	0.00%	0.00%	NA
Indica I	595	95.10%	4.90%	0.00%	0.00%	NA
Indica II	465	84.70%	15.30%	0.00%	0.00%	NA
Indica III	913	77.00%	23.00%	0.00%	0.00%	NA
Indica Intermediate	786	74.60%	25.30%	0.13%	0.00%	NA
Temperate Japonica	767	54.80%	45.20%	0.00%	0.00%	NA
Tropical Japonica	504	92.10%	7.90%	0.00%	0.00%	NA
Japonica Intermediate	241	37.80%	62.20%	0.00%	0.00%	NA
VI/Aromatic	96	50.00%	50.00%	0.00%	0.00%	NA
Intermediate	90	71.10%	28.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0406960814	G -> A	LOC_Os04g12560.1	upstream_gene_variant ; 2890.0bp to feature; MODIFIER	silent_mutation	Average:72.159; most accessible tissue: Zhenshan97 young leaf, score: 87.153	N	N	N	N
vg0406960814	G -> A	LOC_Os04g12570.1	upstream_gene_variant ; 1195.0bp to feature; MODIFIER	silent_mutation	Average:72.159; most accessible tissue: Zhenshan97 young leaf, score: 87.153	N	N	N	N
vg0406960814	G -> A	LOC_Os04g12570-LOC_Os04g12580	intergenic_region ; MODIFIER	silent_mutation	Average:72.159; most accessible tissue: Zhenshan97 young leaf, score: 87.153	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0406960814	NA	1.02E-07	mr1126	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406960814	NA	4.70E-07	mr1157	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406960814	1.54E-06	9.93E-08	mr1286	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406960814	NA	8.14E-06	mr1372	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406960814	NA	2.06E-08	mr1446	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406960814	NA	1.15E-07	mr1515	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406960814	NA	5.31E-06	mr1537	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406960814	3.81E-06	6.89E-07	mr1619	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406960814	NA	1.67E-06	mr1649	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406960814	1.07E-06	1.70E-07	mr1665	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406960814	NA	6.72E-06	mr1667	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406960814	6.58E-08	6.58E-08	mr1777	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406960814	9.30E-06	NA	mr1891	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406960814	NA	4.92E-06	mr1976	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251