\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406883539:

Variant ID: vg0406883539 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 6883539
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, T: 0.06, others allele: 0.00, population size: 84. )

Flanking Sequence (100 bp) in Reference Genome:


GTCTCATGTGTTGAGACGAGGCTTATGTGTTGGGCAGTCGCGGAGTGCGGGTAAAGTGTACATCCACTGCAGTGTGAGTAAACCAAATCTATTCGAATAG[T/C]
CGTGCTCGCGGTTACTGAGCACCGGGACATGTATTACACTTGGCTAGACTCTAAATTCTTAACCTGTGTGGGATGGGATATTGCATGATGATTTTTATGC

Reverse complement sequence

GCATAAAAATCATCATGCAATATCCCATCCCACACAGGTTAAGAATTTAGAGTCTAGCCAAGTGTAATACATGTCCCGGTGCTCAGTAACCGCGAGCACG[A/G]
CTATTCGAATAGATTTGGTTTACTCACACTGCAGTGGATGTACACTTTACCCGCACTCCGCGACTGCCCAACACATAAGCCTCGTCTCAACACATGAGAC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.70% 13.10% 13.33% 1.95% NA
All Indica  2759 59.00% 20.10% 19.14% 1.78% NA
All Japonica  1512 95.60% 0.60% 1.59% 2.18% NA
Aus  269 74.70% 1.90% 20.82% 2.60% NA
Indica I  595 75.80% 6.60% 16.47% 1.18% NA
Indica II  465 47.30% 17.20% 33.55% 1.94% NA
Indica III  913 58.40% 26.70% 12.49% 2.41% NA
Indica Intermediate  786 53.80% 24.40% 20.36% 1.40% NA
Temperate Japonica  767 96.30% 0.40% 1.17% 2.09% NA
Tropical Japonica  504 95.80% 0.80% 1.79% 1.59% NA
Japonica Intermediate  241 92.90% 0.80% 2.49% 3.73% NA
VI/Aromatic  96 49.00% 34.40% 14.58% 2.08% NA
Intermediate  90 73.30% 16.70% 8.89% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0406883539 T -> C LOC_Os04g12450.1 upstream_gene_variant ; 3380.0bp to feature; MODIFIER silent_mutation Average:25.326; most accessible tissue: Minghui63 flag leaf, score: 56.489 N N N N
vg0406883539 T -> C LOC_Os04g12450-LOC_Os04g12460 intergenic_region ; MODIFIER silent_mutation Average:25.326; most accessible tissue: Minghui63 flag leaf, score: 56.489 N N N N
vg0406883539 T -> DEL N N silent_mutation Average:25.326; most accessible tissue: Minghui63 flag leaf, score: 56.489 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0406883539 3.27E-06 4.38E-06 mr1054 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406883539 3.11E-07 3.11E-07 mr1054 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406883539 NA 9.72E-06 mr1286 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406883539 9.12E-07 9.12E-07 mr1287 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406883539 5.83E-06 5.83E-06 mr1293 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406883539 9.83E-06 2.34E-06 mr1303 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406883539 3.95E-06 3.95E-06 mr1303 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406883539 NA 9.24E-06 mr1320 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406883539 NA 8.15E-07 mr1338 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406883539 4.03E-06 3.72E-06 mr1372 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406883539 5.11E-07 2.98E-07 mr1372 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406883539 NA 8.80E-06 mr1426 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406883539 3.92E-06 1.40E-08 mr1439 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406883539 4.55E-06 3.36E-06 mr1439 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406883539 4.57E-06 NA mr1537 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406883539 7.43E-07 3.45E-07 mr1537 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406883539 8.63E-06 2.06E-06 mr1594 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406883539 6.60E-06 6.60E-06 mr1700 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406883539 1.47E-06 1.47E-06 mr1777 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406883539 2.92E-06 1.58E-06 mr1972 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406883539 8.07E-07 8.07E-07 mr1972 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406883539 NA 8.23E-06 mr1976 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406883539 NA 9.82E-07 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251