\
| Variant ID: vg0406853685 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 6853685 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.02, others allele: 0.00, population size: 103. )
AAGAAAGAAGAAGAAGAGAACCGCAAGAGCAAGAGCAAGGCAGAGATCGATGATGAAGAGATGGCTCTCTTCGTCAAGAAGTTCAGCAAGTTCATGAGGC[G/A]
AAGCGGCTTCTTCAAGGGAGGTTCTTCCAACCACTACTCCAACAAGTCAAGTGGAAGACACTCCACAAGAGTGTGCTACGTGTGCAAAGAGCCCGGGCAC
GTGCCCGGGCTCTTTGCACACGTAGCACACTCTTGTGGAGTGTCTTCCACTTGACTTGTTGGAGTAGTGGTTGGAAGAACCTCCCTTGAAGAAGCCGCTT[C/T]
GCCTCATGAACTTGCTGAACTTCTTGACGAAGAGAGCCATCTCTTCATCATCGATCTCTGCCTTGCTCTTGCTCTTGCGGTTCTCTTCTTCTTCTTTCTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 74.20% | 11.00% | 3.77% | 11.02% | NA |
| All Indica | 2759 | 62.50% | 18.30% | 5.80% | 13.45% | NA |
| All Japonica | 1512 | 95.80% | 0.30% | 0.46% | 3.44% | NA |
| Aus | 269 | 71.70% | 0.00% | 2.97% | 25.28% | NA |
| Indica I | 595 | 77.10% | 6.10% | 3.19% | 13.61% | NA |
| Indica II | 465 | 71.00% | 15.50% | 1.29% | 12.26% | NA |
| Indica III | 913 | 49.90% | 23.70% | 11.39% | 15.01% | NA |
| Indica Intermediate | 786 | 60.80% | 23.00% | 3.94% | 12.21% | NA |
| Temperate Japonica | 767 | 97.10% | 0.10% | 0.00% | 2.74% | NA |
| Tropical Japonica | 504 | 95.40% | 0.80% | 0.99% | 2.78% | NA |
| Japonica Intermediate | 241 | 92.10% | 0.00% | 0.83% | 7.05% | NA |
| VI/Aromatic | 96 | 74.00% | 0.00% | 3.12% | 22.92% | NA |
| Intermediate | 90 | 81.10% | 10.00% | 0.00% | 8.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0406853685 | G -> DEL | LOC_Os04g12410.1 | N | frameshift_variant | Average:27.265; most accessible tissue: Minghui63 flag leaf, score: 47.544 | N | N | N | N |
| vg0406853685 | G -> A | LOC_Os04g12410.1 | missense_variant ; p.Arg286Gln; MODERATE | nonsynonymous_codon ; R286Q | Average:27.265; most accessible tissue: Minghui63 flag leaf, score: 47.544 | benign |
0.107 |
TOLERATED | 0.27 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0406853685 | NA | 2.81E-06 | mr1015 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406853685 | 5.12E-06 | 4.82E-06 | mr1054 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406853685 | 4.99E-06 | 4.99E-06 | mr1054 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406853685 | NA | 8.01E-06 | mr1287 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406853685 | 8.82E-06 | 8.82E-06 | mr1287 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406853685 | NA | 5.79E-06 | mr1305 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406853685 | NA | 6.16E-06 | mr1314 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406853685 | NA | 6.48E-06 | mr1320 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406853685 | NA | 6.63E-06 | mr1372 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406853685 | NA | 4.96E-06 | mr1372 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406853685 | NA | 3.19E-06 | mr1409 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406853685 | NA | 1.88E-06 | mr1515 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406853685 | NA | 2.06E-06 | mr1537 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406853685 | 3.03E-06 | NA | mr1661 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406853685 | 7.61E-06 | 4.13E-06 | mr1687 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406853685 | 5.96E-06 | 1.80E-06 | mr1972 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406853685 | 9.04E-06 | 9.04E-06 | mr1972 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |