\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406833799:

Variant ID: vg0406833799 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 6833799
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GATGTATTGTGATCTGTGATGCATTTCTTTCCAATATGTGATGTATTTCTTTCCAGATCTGTGATGCTACTTTGATTTGGGGATGATTTGGGAATATGAT[C/T]
GGGGATATTTAGGGAGCAGATCGATTTGAGAAAAAAAAATAACCGGAACTGCTCCTGATGGATTTTTAGTCCCGGTTATTTTACCCGGGAGCGTAACTCC

Reverse complement sequence

GGAGTTACGCTCCCGGGTAAAATAACCGGGACTAAAAATCCATCAGGAGCAGTTCCGGTTATTTTTTTTTCTCAAATCGATCTGCTCCCTAAATATCCCC[G/A]
ATCATATTCCCAAATCATCCCCAAATCAAAGTAGCATCACAGATCTGGAAAGAAATACATCACATATTGGAAAGAAATGCATCACAGATCACAATACATC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.40% 4.00% 0.42% 36.20% NA
All Indica  2759 36.10% 6.60% 0.62% 56.65% NA
All Japonica  1512 98.30% 0.10% 0.07% 1.59% NA
Aus  269 81.80% 0.00% 0.00% 18.22% NA
Indica I  595 28.10% 4.70% 1.18% 66.05% NA
Indica II  465 56.30% 7.10% 0.43% 36.13% NA
Indica III  913 32.00% 2.60% 0.44% 64.95% NA
Indica Intermediate  786 35.00% 12.50% 0.51% 52.04% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 97.20% 0.00% 0.00% 2.78% NA
Japonica Intermediate  241 95.40% 0.00% 0.41% 4.15% NA
VI/Aromatic  96 43.80% 0.00% 0.00% 56.25% NA
Intermediate  90 70.00% 4.40% 2.22% 23.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0406833799 C -> DEL N N silent_mutation Average:45.653; most accessible tissue: Callus, score: 84.508 N N N N
vg0406833799 C -> T LOC_Os04g12380.1 upstream_gene_variant ; 3943.0bp to feature; MODIFIER silent_mutation Average:45.653; most accessible tissue: Callus, score: 84.508 N N N N
vg0406833799 C -> T LOC_Os04g12390.1 downstream_gene_variant ; 111.0bp to feature; MODIFIER silent_mutation Average:45.653; most accessible tissue: Callus, score: 84.508 N N N N
vg0406833799 C -> T LOC_Os04g12380-LOC_Os04g12390 intergenic_region ; MODIFIER silent_mutation Average:45.653; most accessible tissue: Callus, score: 84.508 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0406833799 3.30E-07 1.22E-09 mr1166 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406833799 NA 2.83E-06 mr1305 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406833799 NA 1.80E-06 mr1409 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406833799 NA 8.70E-06 mr1509 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406833799 NA 4.46E-07 mr1515 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406833799 NA 6.25E-08 mr1649 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406833799 6.40E-06 6.40E-06 mr1777 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251