Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0406833799:

Variant ID: vg0406833799 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 6833799
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GATGTATTGTGATCTGTGATGCATTTCTTTCCAATATGTGATGTATTTCTTTCCAGATCTGTGATGCTACTTTGATTTGGGGATGATTTGGGAATATGAT[C/T]
GGGGATATTTAGGGAGCAGATCGATTTGAGAAAAAAAAATAACCGGAACTGCTCCTGATGGATTTTTAGTCCCGGTTATTTTACCCGGGAGCGTAACTCC

Reverse complement sequence

GGAGTTACGCTCCCGGGTAAAATAACCGGGACTAAAAATCCATCAGGAGCAGTTCCGGTTATTTTTTTTTCTCAAATCGATCTGCTCCCTAAATATCCCC[G/A]
ATCATATTCCCAAATCATCCCCAAATCAAAGTAGCATCACAGATCTGGAAAGAAATACATCACATATTGGAAAGAAATGCATCACAGATCACAATACATC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.40%	4.00%	0.42%	36.20%	NA
All Indica	2759	36.10%	6.60%	0.62%	56.65%	NA
All Japonica	1512	98.30%	0.10%	0.07%	1.59%	NA
Aus	269	81.80%	0.00%	0.00%	18.22%	NA
Indica I	595	28.10%	4.70%	1.18%	66.05%	NA
Indica II	465	56.30%	7.10%	0.43%	36.13%	NA
Indica III	913	32.00%	2.60%	0.44%	64.95%	NA
Indica Intermediate	786	35.00%	12.50%	0.51%	52.04%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	97.20%	0.00%	0.00%	2.78%	NA
Japonica Intermediate	241	95.40%	0.00%	0.41%	4.15%	NA
VI/Aromatic	96	43.80%	0.00%	0.00%	56.25%	NA
Intermediate	90	70.00%	4.40%	2.22%	23.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0406833799	C -> DEL	N	N	silent_mutation	Average:45.653; most accessible tissue: Callus, score: 84.508	N	N	N	N
vg0406833799	C -> T	LOC_Os04g12380.1	upstream_gene_variant ; 3943.0bp to feature; MODIFIER	silent_mutation	Average:45.653; most accessible tissue: Callus, score: 84.508	N	N	N	N
vg0406833799	C -> T	LOC_Os04g12390.1	downstream_gene_variant ; 111.0bp to feature; MODIFIER	silent_mutation	Average:45.653; most accessible tissue: Callus, score: 84.508	N	N	N	N
vg0406833799	C -> T	LOC_Os04g12380-LOC_Os04g12390	intergenic_region ; MODIFIER	silent_mutation	Average:45.653; most accessible tissue: Callus, score: 84.508	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0406833799	3.30E-07	1.22E-09	mr1166	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406833799	NA	2.83E-06	mr1305	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406833799	NA	1.80E-06	mr1409	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406833799	NA	8.70E-06	mr1509	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406833799	NA	4.46E-07	mr1515	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406833799	NA	6.25E-08	mr1649	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406833799	6.40E-06	6.40E-06	mr1777	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251