\
| Variant ID: vg0406833799 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 6833799 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GATGTATTGTGATCTGTGATGCATTTCTTTCCAATATGTGATGTATTTCTTTCCAGATCTGTGATGCTACTTTGATTTGGGGATGATTTGGGAATATGAT[C/T]
GGGGATATTTAGGGAGCAGATCGATTTGAGAAAAAAAAATAACCGGAACTGCTCCTGATGGATTTTTAGTCCCGGTTATTTTACCCGGGAGCGTAACTCC
GGAGTTACGCTCCCGGGTAAAATAACCGGGACTAAAAATCCATCAGGAGCAGTTCCGGTTATTTTTTTTTCTCAAATCGATCTGCTCCCTAAATATCCCC[G/A]
ATCATATTCCCAAATCATCCCCAAATCAAAGTAGCATCACAGATCTGGAAAGAAATACATCACATATTGGAAAGAAATGCATCACAGATCACAATACATC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 59.40% | 4.00% | 0.42% | 36.20% | NA |
| All Indica | 2759 | 36.10% | 6.60% | 0.62% | 56.65% | NA |
| All Japonica | 1512 | 98.30% | 0.10% | 0.07% | 1.59% | NA |
| Aus | 269 | 81.80% | 0.00% | 0.00% | 18.22% | NA |
| Indica I | 595 | 28.10% | 4.70% | 1.18% | 66.05% | NA |
| Indica II | 465 | 56.30% | 7.10% | 0.43% | 36.13% | NA |
| Indica III | 913 | 32.00% | 2.60% | 0.44% | 64.95% | NA |
| Indica Intermediate | 786 | 35.00% | 12.50% | 0.51% | 52.04% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 97.20% | 0.00% | 0.00% | 2.78% | NA |
| Japonica Intermediate | 241 | 95.40% | 0.00% | 0.41% | 4.15% | NA |
| VI/Aromatic | 96 | 43.80% | 0.00% | 0.00% | 56.25% | NA |
| Intermediate | 90 | 70.00% | 4.40% | 2.22% | 23.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0406833799 | C -> DEL | N | N | silent_mutation | Average:45.653; most accessible tissue: Callus, score: 84.508 | N | N | N | N |
| vg0406833799 | C -> T | LOC_Os04g12380.1 | upstream_gene_variant ; 3943.0bp to feature; MODIFIER | silent_mutation | Average:45.653; most accessible tissue: Callus, score: 84.508 | N | N | N | N |
| vg0406833799 | C -> T | LOC_Os04g12390.1 | downstream_gene_variant ; 111.0bp to feature; MODIFIER | silent_mutation | Average:45.653; most accessible tissue: Callus, score: 84.508 | N | N | N | N |
| vg0406833799 | C -> T | LOC_Os04g12380-LOC_Os04g12390 | intergenic_region ; MODIFIER | silent_mutation | Average:45.653; most accessible tissue: Callus, score: 84.508 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0406833799 | 3.30E-07 | 1.22E-09 | mr1166 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406833799 | NA | 2.83E-06 | mr1305 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406833799 | NA | 1.80E-06 | mr1409 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406833799 | NA | 8.70E-06 | mr1509 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406833799 | NA | 4.46E-07 | mr1515 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406833799 | NA | 6.25E-08 | mr1649 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406833799 | 6.40E-06 | 6.40E-06 | mr1777 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |