Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0406825130:

Variant ID: vg0406825130 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 6825130
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTTGTCCTCTACTGAAAGATGTTAGCCGATTGTAGGTTAGATAGCGATATTGCCAGAGATTATGTAAGATATATGATAACTCGACGAATTACATAAACAA[G/T]
ATTAGAGTGTCATAAAAATGGAAGCACTAATCCCGAGAACGCAAGCCGTCATAACAAGTTTTACCTCTTGTTGAAGATCGAAACCGATGCAGCTCAACCC

Reverse complement sequence

GGGTTGAGCTGCATCGGTTTCGATCTTCAACAAGAGGTAAAACTTGTTATGACGGCTTGCGTTCTCGGGATTAGTGCTTCCATTTTTATGACACTCTAAT[C/A]
TTGTTTATGTAATTCGTCGAGTTATCATATATCTTACATAATCTCTGGCAATATCGCTATCTAACCTACAATCGGCTAACATCTTTCAGTAGAGGACAAC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.70%	0.90%	9.52%	0.85%	NA
All Indica	2759	81.80%	1.50%	15.44%	1.23%	NA
All Japonica	1512	98.40%	0.00%	1.32%	0.26%	NA
Aus	269	99.60%	0.00%	0.37%	0.00%	NA
Indica I	595	80.00%	0.80%	18.15%	1.01%	NA
Indica II	465	83.20%	0.60%	14.62%	1.51%	NA
Indica III	913	80.20%	1.50%	16.98%	1.31%	NA
Indica Intermediate	786	84.20%	2.50%	12.09%	1.15%	NA
Temperate Japonica	767	97.90%	0.00%	1.83%	0.26%	NA
Tropical Japonica	504	98.60%	0.00%	0.99%	0.40%	NA
Japonica Intermediate	241	99.60%	0.00%	0.41%	0.00%	NA
VI/Aromatic	96	97.90%	1.00%	1.04%	0.00%	NA
Intermediate	90	94.40%	1.10%	2.22%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0406825130	G -> DEL	N	N	silent_mutation	Average:19.078; most accessible tissue: Minghui63 young leaf, score: 40.718	N	N	N	N
vg0406825130	G -> T	LOC_Os04g12370.1	downstream_gene_variant ; 2464.0bp to feature; MODIFIER	silent_mutation	Average:19.078; most accessible tissue: Minghui63 young leaf, score: 40.718	N	N	N	N
vg0406825130	G -> T	LOC_Os04g12380.1	downstream_gene_variant ; 4455.0bp to feature; MODIFIER	silent_mutation	Average:19.078; most accessible tissue: Minghui63 young leaf, score: 40.718	N	N	N	N
vg0406825130	G -> T	LOC_Os04g12370-LOC_Os04g12380	intergenic_region ; MODIFIER	silent_mutation	Average:19.078; most accessible tissue: Minghui63 young leaf, score: 40.718	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0406825130	3.53E-07	1.86E-11	mr1172_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406825130	NA	2.87E-06	mr1172_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251