\
| Variant ID: vg0406825130 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 6825130 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GTTGTCCTCTACTGAAAGATGTTAGCCGATTGTAGGTTAGATAGCGATATTGCCAGAGATTATGTAAGATATATGATAACTCGACGAATTACATAAACAA[G/T]
ATTAGAGTGTCATAAAAATGGAAGCACTAATCCCGAGAACGCAAGCCGTCATAACAAGTTTTACCTCTTGTTGAAGATCGAAACCGATGCAGCTCAACCC
GGGTTGAGCTGCATCGGTTTCGATCTTCAACAAGAGGTAAAACTTGTTATGACGGCTTGCGTTCTCGGGATTAGTGCTTCCATTTTTATGACACTCTAAT[C/A]
TTGTTTATGTAATTCGTCGAGTTATCATATATCTTACATAATCTCTGGCAATATCGCTATCTAACCTACAATCGGCTAACATCTTTCAGTAGAGGACAAC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.70% | 0.90% | 9.52% | 0.85% | NA |
| All Indica | 2759 | 81.80% | 1.50% | 15.44% | 1.23% | NA |
| All Japonica | 1512 | 98.40% | 0.00% | 1.32% | 0.26% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.37% | 0.00% | NA |
| Indica I | 595 | 80.00% | 0.80% | 18.15% | 1.01% | NA |
| Indica II | 465 | 83.20% | 0.60% | 14.62% | 1.51% | NA |
| Indica III | 913 | 80.20% | 1.50% | 16.98% | 1.31% | NA |
| Indica Intermediate | 786 | 84.20% | 2.50% | 12.09% | 1.15% | NA |
| Temperate Japonica | 767 | 97.90% | 0.00% | 1.83% | 0.26% | NA |
| Tropical Japonica | 504 | 98.60% | 0.00% | 0.99% | 0.40% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 1.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 1.10% | 2.22% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0406825130 | G -> DEL | N | N | silent_mutation | Average:19.078; most accessible tissue: Minghui63 young leaf, score: 40.718 | N | N | N | N |
| vg0406825130 | G -> T | LOC_Os04g12370.1 | downstream_gene_variant ; 2464.0bp to feature; MODIFIER | silent_mutation | Average:19.078; most accessible tissue: Minghui63 young leaf, score: 40.718 | N | N | N | N |
| vg0406825130 | G -> T | LOC_Os04g12380.1 | downstream_gene_variant ; 4455.0bp to feature; MODIFIER | silent_mutation | Average:19.078; most accessible tissue: Minghui63 young leaf, score: 40.718 | N | N | N | N |
| vg0406825130 | G -> T | LOC_Os04g12370-LOC_Os04g12380 | intergenic_region ; MODIFIER | silent_mutation | Average:19.078; most accessible tissue: Minghui63 young leaf, score: 40.718 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0406825130 | 3.53E-07 | 1.86E-11 | mr1172_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406825130 | NA | 2.87E-06 | mr1172_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |