\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406825130:

Variant ID: vg0406825130 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 6825130
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTTGTCCTCTACTGAAAGATGTTAGCCGATTGTAGGTTAGATAGCGATATTGCCAGAGATTATGTAAGATATATGATAACTCGACGAATTACATAAACAA[G/T]
ATTAGAGTGTCATAAAAATGGAAGCACTAATCCCGAGAACGCAAGCCGTCATAACAAGTTTTACCTCTTGTTGAAGATCGAAACCGATGCAGCTCAACCC

Reverse complement sequence

GGGTTGAGCTGCATCGGTTTCGATCTTCAACAAGAGGTAAAACTTGTTATGACGGCTTGCGTTCTCGGGATTAGTGCTTCCATTTTTATGACACTCTAAT[C/A]
TTGTTTATGTAATTCGTCGAGTTATCATATATCTTACATAATCTCTGGCAATATCGCTATCTAACCTACAATCGGCTAACATCTTTCAGTAGAGGACAAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.70% 0.90% 9.52% 0.85% NA
All Indica  2759 81.80% 1.50% 15.44% 1.23% NA
All Japonica  1512 98.40% 0.00% 1.32% 0.26% NA
Aus  269 99.60% 0.00% 0.37% 0.00% NA
Indica I  595 80.00% 0.80% 18.15% 1.01% NA
Indica II  465 83.20% 0.60% 14.62% 1.51% NA
Indica III  913 80.20% 1.50% 16.98% 1.31% NA
Indica Intermediate  786 84.20% 2.50% 12.09% 1.15% NA
Temperate Japonica  767 97.90% 0.00% 1.83% 0.26% NA
Tropical Japonica  504 98.60% 0.00% 0.99% 0.40% NA
Japonica Intermediate  241 99.60% 0.00% 0.41% 0.00% NA
VI/Aromatic  96 97.90% 1.00% 1.04% 0.00% NA
Intermediate  90 94.40% 1.10% 2.22% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0406825130 G -> DEL N N silent_mutation Average:19.078; most accessible tissue: Minghui63 young leaf, score: 40.718 N N N N
vg0406825130 G -> T LOC_Os04g12370.1 downstream_gene_variant ; 2464.0bp to feature; MODIFIER silent_mutation Average:19.078; most accessible tissue: Minghui63 young leaf, score: 40.718 N N N N
vg0406825130 G -> T LOC_Os04g12380.1 downstream_gene_variant ; 4455.0bp to feature; MODIFIER silent_mutation Average:19.078; most accessible tissue: Minghui63 young leaf, score: 40.718 N N N N
vg0406825130 G -> T LOC_Os04g12370-LOC_Os04g12380 intergenic_region ; MODIFIER silent_mutation Average:19.078; most accessible tissue: Minghui63 young leaf, score: 40.718 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0406825130 3.53E-07 1.86E-11 mr1172_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406825130 NA 2.87E-06 mr1172_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251