\
| Variant ID: vg0406818237 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 6818237 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TTACCTTGTACTTTTGCACCATTGTCCCCTTGCGGGTCTGCATAAATGAGTTTAAGAACTGGTTCCGTGCTTGCTGCATCATCGCTTCAAAATCTTTCTT[T/C]
TGATCGGGTGTCAGCTTGTCTGGAGTAATGTTCACGATGTTGCCTTCATTAACCTCGTATTGGTCTAACTGCTGGATCTTCACTTTAACAGAACCTGGGC
GCCCAGGTTCTGTTAAAGTGAAGATCCAGCAGTTAGACCAATACGAGGTTAATGAAGGCAACATCGTGAACATTACTCCAGACAAGCTGACACCCGATCA[A/G]
AAGAAAGATTTTGAAGCGATGATGCAGCAAGCACGGAACCAGTTCTTAAACTCATTTATGCAGACCCGCAAGGGGACAATGGTGCAAAAGTACAAGGTAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 55.10% | 0.30% | 7.53% | 37.05% | NA |
| All Indica | 2759 | 36.40% | 0.50% | 10.87% | 52.19% | NA |
| All Japonica | 1512 | 98.10% | 0.00% | 0.07% | 1.85% | NA |
| Aus | 269 | 10.80% | 0.00% | 14.13% | 75.09% | NA |
| Indica I | 595 | 40.30% | 0.20% | 11.26% | 48.24% | NA |
| Indica II | 465 | 35.90% | 0.90% | 7.53% | 55.70% | NA |
| Indica III | 913 | 32.00% | 0.40% | 13.36% | 54.22% | NA |
| Indica Intermediate | 786 | 38.80% | 0.80% | 9.67% | 50.76% | NA |
| Temperate Japonica | 767 | 99.90% | 0.00% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 96.80% | 0.00% | 0.20% | 2.98% | NA |
| Japonica Intermediate | 241 | 95.00% | 0.00% | 0.00% | 4.98% | NA |
| VI/Aromatic | 96 | 27.10% | 0.00% | 15.62% | 57.29% | NA |
| Intermediate | 90 | 67.80% | 1.10% | 2.22% | 28.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0406818237 | T -> C | LOC_Os04g12360.1 | synonymous_variant ; p.Gln46Gln; LOW | synonymous_codon | Average:43.951; most accessible tissue: Minghui63 young leaf, score: 78.443 | N | N | N | N |
| vg0406818237 | T -> DEL | LOC_Os04g12360.1 | N | frameshift_variant | Average:43.951; most accessible tissue: Minghui63 young leaf, score: 78.443 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0406818237 | NA | 1.64E-06 | mr1015 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406818237 | NA | 4.14E-13 | mr1035 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406818237 | NA | 1.17E-06 | mr1305 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406818237 | NA | 1.50E-06 | mr1409 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406818237 | NA | 9.53E-06 | mr1515 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406818237 | NA | 3.16E-12 | mr1626 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406818237 | NA | 4.27E-06 | mr1649 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406818237 | 1.95E-06 | 1.95E-06 | mr1687 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406818237 | NA | 3.85E-06 | mr1895 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406818237 | NA | 3.39E-07 | mr1915 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406818237 | 5.17E-07 | 5.16E-07 | mr1966 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406818237 | 4.02E-06 | 4.02E-06 | mr1972 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406818237 | NA | 5.82E-18 | mr1239_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406818237 | NA | 1.56E-16 | mr1715_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |