\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406812732:

Variant ID: vg0406812732 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 6812732
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAGAGAAGCCGATTGAAATGGATTCTGCAAATATTGATGTACATCATATCTCCAATCATCGGCTGTTATCGAGGCAACCTCAACCTCAACATCTTTGATC[A/G]
TCGGCTTATACCCTGATGCCCCTTGGGCCAAATCATTAGCTTCACTGTTTTGTTCCCGAGATACATACTTCAAAGTAACCAGTCGAAATTCCTTCATTAG

Reverse complement sequence

CTAATGAAGGAATTTCGACTGGTTACTTTGAAGTATGTATCTCGGGAACAAAACAGTGAAGCTAATGATTTGGCCCAAGGGGCATCAGGGTATAAGCCGA[T/C]
GATCAAAGATGTTGAGGTTGAGGTTGCCTCGATAACAGCCGATGATTGGAGATATGATGTACATCAATATTTGCAGAATCCATTTCAATCGGCTTCTCTG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.60% 8.00% 0.53% 1.88% NA
All Indica  2759 83.40% 13.30% 0.80% 2.50% NA
All Japonica  1512 98.90% 0.00% 0.20% 0.93% NA
Aus  269 97.40% 2.60% 0.00% 0.00% NA
Indica I  595 84.90% 13.10% 1.68% 0.34% NA
Indica II  465 95.10% 4.10% 0.00% 0.86% NA
Indica III  913 76.60% 19.20% 0.44% 3.83% NA
Indica Intermediate  786 83.30% 12.10% 1.02% 3.56% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 98.20% 0.00% 0.20% 1.59% NA
Japonica Intermediate  241 96.70% 0.00% 0.83% 2.49% NA
VI/Aromatic  96 99.00% 0.00% 0.00% 1.04% NA
Intermediate  90 92.20% 2.20% 0.00% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0406812732 A -> DEL N N silent_mutation Average:12.056; most accessible tissue: Callus, score: 36.528 N N N N
vg0406812732 A -> G LOC_Os04g12340.1 upstream_gene_variant ; 2896.0bp to feature; MODIFIER silent_mutation Average:12.056; most accessible tissue: Callus, score: 36.528 N N N N
vg0406812732 A -> G LOC_Os04g12330.1 downstream_gene_variant ; 4019.0bp to feature; MODIFIER silent_mutation Average:12.056; most accessible tissue: Callus, score: 36.528 N N N N
vg0406812732 A -> G LOC_Os04g12350.1 downstream_gene_variant ; 97.0bp to feature; MODIFIER silent_mutation Average:12.056; most accessible tissue: Callus, score: 36.528 N N N N
vg0406812732 A -> G LOC_Os04g12360.1 downstream_gene_variant ; 4888.0bp to feature; MODIFIER silent_mutation Average:12.056; most accessible tissue: Callus, score: 36.528 N N N N
vg0406812732 A -> G LOC_Os04g12340-LOC_Os04g12350 intergenic_region ; MODIFIER silent_mutation Average:12.056; most accessible tissue: Callus, score: 36.528 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0406812732 NA 3.52E-06 mr1031 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406812732 NA 3.43E-06 mr1163 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406812732 2.46E-06 2.47E-06 mr1966 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406812732 6.95E-06 6.94E-06 mr1966 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251