Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0406812732:

Variant ID: vg0406812732 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 6812732
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CAGAGAAGCCGATTGAAATGGATTCTGCAAATATTGATGTACATCATATCTCCAATCATCGGCTGTTATCGAGGCAACCTCAACCTCAACATCTTTGATC[A/G]
TCGGCTTATACCCTGATGCCCCTTGGGCCAAATCATTAGCTTCACTGTTTTGTTCCCGAGATACATACTTCAAAGTAACCAGTCGAAATTCCTTCATTAG

Reverse complement sequence

CTAATGAAGGAATTTCGACTGGTTACTTTGAAGTATGTATCTCGGGAACAAAACAGTGAAGCTAATGATTTGGCCCAAGGGGCATCAGGGTATAAGCCGA[T/C]
GATCAAAGATGTTGAGGTTGAGGTTGCCTCGATAACAGCCGATGATTGGAGATATGATGTACATCAATATTTGCAGAATCCATTTCAATCGGCTTCTCTG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.60%	8.00%	0.53%	1.88%	NA
All Indica	2759	83.40%	13.30%	0.80%	2.50%	NA
All Japonica	1512	98.90%	0.00%	0.20%	0.93%	NA
Aus	269	97.40%	2.60%	0.00%	0.00%	NA
Indica I	595	84.90%	13.10%	1.68%	0.34%	NA
Indica II	465	95.10%	4.10%	0.00%	0.86%	NA
Indica III	913	76.60%	19.20%	0.44%	3.83%	NA
Indica Intermediate	786	83.30%	12.10%	1.02%	3.56%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	98.20%	0.00%	0.20%	1.59%	NA
Japonica Intermediate	241	96.70%	0.00%	0.83%	2.49%	NA
VI/Aromatic	96	99.00%	0.00%	0.00%	1.04%	NA
Intermediate	90	92.20%	2.20%	0.00%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0406812732	A -> DEL	N	N	silent_mutation	Average:12.056; most accessible tissue: Callus, score: 36.528	N	N	N	N
vg0406812732	A -> G	LOC_Os04g12340.1	upstream_gene_variant ; 2896.0bp to feature; MODIFIER	silent_mutation	Average:12.056; most accessible tissue: Callus, score: 36.528	N	N	N	N
vg0406812732	A -> G	LOC_Os04g12330.1	downstream_gene_variant ; 4019.0bp to feature; MODIFIER	silent_mutation	Average:12.056; most accessible tissue: Callus, score: 36.528	N	N	N	N
vg0406812732	A -> G	LOC_Os04g12350.1	downstream_gene_variant ; 97.0bp to feature; MODIFIER	silent_mutation	Average:12.056; most accessible tissue: Callus, score: 36.528	N	N	N	N
vg0406812732	A -> G	LOC_Os04g12360.1	downstream_gene_variant ; 4888.0bp to feature; MODIFIER	silent_mutation	Average:12.056; most accessible tissue: Callus, score: 36.528	N	N	N	N
vg0406812732	A -> G	LOC_Os04g12340-LOC_Os04g12350	intergenic_region ; MODIFIER	silent_mutation	Average:12.056; most accessible tissue: Callus, score: 36.528	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0406812732	NA	3.52E-06	mr1031	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406812732	NA	3.43E-06	mr1163	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406812732	2.46E-06	2.47E-06	mr1966	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406812732	6.95E-06	6.94E-06	mr1966	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251