\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406791284:

Variant ID: vg0406791284 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 6791284
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.72, T: 0.28, others allele: 0.00, population size: 53. )

Flanking Sequence (100 bp) in Reference Genome:


AAAATCCATCGGACTTCAGATTTGAAGACATTAACCATAAAAGATACCAAAAGTCCAGGTAAGTTTTCTCAACTACAATCAGCCCATGCATCTTACCCGT[T/C]
GGCATCCACCAAGGGAGAAACATTCCAGTCTCCTACGAATTCTACCATCCAATGAGTTCAGCTAGACAACTTGGAATGGGCCAACTCCCAATCGACTTAT

Reverse complement sequence

ATAAGTCGATTGGGAGTTGGCCCATTCCAAGTTGTCTAGCTGAACTCATTGGATGGTAGAATTCGTAGGAGACTGGAATGTTTCTCCCTTGGTGGATGCC[A/G]
ACGGGTAAGATGCATGGGCTGATTGTAGTTGAGAAAACTTACCTGGACTTTTGGTATCTTTTATGGTTAATGTCTTCAAATCTGAAGTCCGATGGATTTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 40.30% 25.60% 1.14% 32.90% NA
All Indica  2759 13.20% 34.00% 1.41% 51.40% NA
All Japonica  1512 95.20% 3.00% 0.13% 1.72% NA
Aus  269 10.80% 70.60% 1.86% 16.73% NA
Indica I  595 28.10% 7.60% 2.86% 61.51% NA
Indica II  465 14.60% 51.60% 1.51% 32.26% NA
Indica III  913 3.20% 38.70% 0.99% 57.17% NA
Indica Intermediate  786 12.60% 38.30% 0.76% 48.35% NA
Temperate Japonica  767 96.60% 3.10% 0.26% 0.00% NA
Tropical Japonica  504 95.40% 1.60% 0.00% 2.98% NA
Japonica Intermediate  241 90.00% 5.40% 0.00% 4.56% NA
VI/Aromatic  96 25.00% 17.70% 5.21% 52.08% NA
Intermediate  90 56.70% 22.20% 3.33% 17.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0406791284 T -> C LOC_Os04g12300.1 synonymous_variant ; p.Val139Val; LOW nonsynonymous_codon ; V139I Average:31.2; most accessible tissue: Minghui63 young leaf, score: 64.378 benign 0.494 TOLERATED 0.06
vg0406791284 T -> DEL LOC_Os04g12300.1 N frameshift_variant Average:31.2; most accessible tissue: Minghui63 young leaf, score: 64.378 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0406791284 NA 3.22E-13 mr1035 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406791284 NA 1.13E-88 mr1071 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406791284 NA 6.76E-90 mr1140 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406791284 NA 1.00E-77 mr1613 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406791284 NA 1.23E-11 mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406791284 NA 7.75E-26 mr1631 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406791284 NA 3.62E-17 mr1913 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406791284 NA 3.62E-13 mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406791284 NA 2.12E-104 mr1071_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406791284 NA 1.37E-24 mr1175_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406791284 NA 5.96E-30 mr1631_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406791284 NA 5.87E-32 mr1913_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251