Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406715803:

Variant ID: vg0406715803 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 6715803
Reference Allele: C	Alternative Allele: G
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:

CTACAAGACAATAATGCATGTCATGCTTCTATATCCTTCAATCAAGAAAGTTCTATTCAAGGTTGGGAAAGAGTGTAATGGGGCAGAGGCTATAGGAGCT[C/G]
AAACTATGCTACAAGTATTTCAGTCATTTGAGTTTGTTTTCTTGTTGCACATGATGAATGAAATATTTGGATACACAAGTGACTTCTGCAATGCTCTGCT

Reverse complement sequence

AGCAGAGCATTGCAGAAGTCACTTGTGTATCCAAATATTTCATTCATCATGTGCAACAAGAAAACAAACTCAAATGACTGAAATACTTGTAGCATAGTTT[G/C]
AGCTCCTATAGCCTCTGCCCCATTACACTCTTTCCCAACCTTGAATAGAACTTTCTTGATTGAAGGATATAGAAGCATGACATGCATTATTGTCTTGTAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.20%	9.90%	3.07%	18.77%	NA
All Indica	2759	56.40%	16.50%	1.78%	25.34%	NA
All Japonica	1512	98.70%	0.30%	0.07%	0.86%	NA
Aus	269	19.00%	1.10%	29.37%	50.56%	NA
Indica I	595	83.90%	6.20%	1.01%	8.91%	NA
Indica II	465	31.20%	14.00%	1.29%	53.55%	NA
Indica III	913	53.80%	21.00%	2.19%	23.00%	NA
Indica Intermediate	786	53.60%	20.50%	2.16%	23.79%	NA
Temperate Japonica	767	99.20%	0.10%	0.13%	0.52%	NA
Tropical Japonica	504	98.40%	0.80%	0.00%	0.79%	NA
Japonica Intermediate	241	97.90%	0.00%	0.00%	2.07%	NA
VI/Aromatic	96	62.50%	0.00%	14.58%	22.92%	NA
Intermediate	90	71.10%	7.80%	2.22%	18.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0406715803	C -> DEL	LOC_Os04g12190.1	N	frameshift_variant	Average:16.783; most accessible tissue: Callus, score: 46.826	N	N	N	N
vg0406715803	C -> G	LOC_Os04g12190.1	missense_variant ; p.Gln394Glu; MODERATE	nonsynonymous_codon ; Q394E	Average:16.783; most accessible tissue: Callus, score: 46.826	benign	0.748	TOLERATED	0.35

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0406715803	NA	6.72E-06	mr1015	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406715803	1.49E-06	4.87E-06	mr1054	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406715803	8.08E-07	8.08E-07	mr1054	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406715803	5.81E-06	1.54E-07	mr1166	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406715803	NA	7.16E-06	mr1233	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406715803	5.45E-06	NA	mr1287	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406715803	2.42E-06	2.42E-06	mr1287	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406715803	NA	1.42E-07	mr1305	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406715803	NA	7.04E-06	mr1314	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406715803	NA	8.48E-06	mr1320	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406715803	8.84E-06	NA	mr1372	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406715803	6.27E-06	2.59E-06	mr1372	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406715803	3.82E-06	3.82E-06	mr1379	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406715803	NA	4.20E-07	mr1409	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406715803	NA	2.39E-06	mr1427	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406715803	NA	7.69E-08	mr1515	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406715803	2.06E-06	6.24E-07	mr1537	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406715803	NA	8.90E-06	mr1559	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406715803	NA	2.26E-06	mr1586	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406715803	NA	3.67E-06	mr1634	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406715803	NA	7.96E-07	mr1649	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406715803	3.58E-06	3.58E-06	mr1661	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406715803	3.84E-07	5.55E-07	mr1687	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406715803	4.13E-07	4.14E-07	mr1687	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406715803	3.96E-06	3.96E-06	mr1777	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406715803	NA	8.74E-06	mr1895	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406715803	NA	2.04E-06	mr1895	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406715803	1.45E-06	1.76E-06	mr1972	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406715803	3.52E-06	3.52E-06	mr1972	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251