\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406715803:

Variant ID: vg0406715803 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 6715803
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:


CTACAAGACAATAATGCATGTCATGCTTCTATATCCTTCAATCAAGAAAGTTCTATTCAAGGTTGGGAAAGAGTGTAATGGGGCAGAGGCTATAGGAGCT[C/G]
AAACTATGCTACAAGTATTTCAGTCATTTGAGTTTGTTTTCTTGTTGCACATGATGAATGAAATATTTGGATACACAAGTGACTTCTGCAATGCTCTGCT

Reverse complement sequence

AGCAGAGCATTGCAGAAGTCACTTGTGTATCCAAATATTTCATTCATCATGTGCAACAAGAAAACAAACTCAAATGACTGAAATACTTGTAGCATAGTTT[G/C]
AGCTCCTATAGCCTCTGCCCCATTACACTCTTTCCCAACCTTGAATAGAACTTTCTTGATTGAAGGATATAGAAGCATGACATGCATTATTGTCTTGTAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.20% 9.90% 3.07% 18.77% NA
All Indica  2759 56.40% 16.50% 1.78% 25.34% NA
All Japonica  1512 98.70% 0.30% 0.07% 0.86% NA
Aus  269 19.00% 1.10% 29.37% 50.56% NA
Indica I  595 83.90% 6.20% 1.01% 8.91% NA
Indica II  465 31.20% 14.00% 1.29% 53.55% NA
Indica III  913 53.80% 21.00% 2.19% 23.00% NA
Indica Intermediate  786 53.60% 20.50% 2.16% 23.79% NA
Temperate Japonica  767 99.20% 0.10% 0.13% 0.52% NA
Tropical Japonica  504 98.40% 0.80% 0.00% 0.79% NA
Japonica Intermediate  241 97.90% 0.00% 0.00% 2.07% NA
VI/Aromatic  96 62.50% 0.00% 14.58% 22.92% NA
Intermediate  90 71.10% 7.80% 2.22% 18.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0406715803 C -> DEL LOC_Os04g12190.1 N frameshift_variant Average:16.783; most accessible tissue: Callus, score: 46.826 N N N N
vg0406715803 C -> G LOC_Os04g12190.1 missense_variant ; p.Gln394Glu; MODERATE nonsynonymous_codon ; Q394E Average:16.783; most accessible tissue: Callus, score: 46.826 benign 0.748 TOLERATED 0.35

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0406715803 NA 6.72E-06 mr1015 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406715803 1.49E-06 4.87E-06 mr1054 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406715803 8.08E-07 8.08E-07 mr1054 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406715803 5.81E-06 1.54E-07 mr1166 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406715803 NA 7.16E-06 mr1233 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406715803 5.45E-06 NA mr1287 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406715803 2.42E-06 2.42E-06 mr1287 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406715803 NA 1.42E-07 mr1305 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406715803 NA 7.04E-06 mr1314 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406715803 NA 8.48E-06 mr1320 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406715803 8.84E-06 NA mr1372 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406715803 6.27E-06 2.59E-06 mr1372 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406715803 3.82E-06 3.82E-06 mr1379 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406715803 NA 4.20E-07 mr1409 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406715803 NA 2.39E-06 mr1427 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406715803 NA 7.69E-08 mr1515 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406715803 2.06E-06 6.24E-07 mr1537 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406715803 NA 8.90E-06 mr1559 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406715803 NA 2.26E-06 mr1586 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406715803 NA 3.67E-06 mr1634 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406715803 NA 7.96E-07 mr1649 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406715803 3.58E-06 3.58E-06 mr1661 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406715803 3.84E-07 5.55E-07 mr1687 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406715803 4.13E-07 4.14E-07 mr1687 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406715803 3.96E-06 3.96E-06 mr1777 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406715803 NA 8.74E-06 mr1895 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406715803 NA 2.04E-06 mr1895 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406715803 1.45E-06 1.76E-06 mr1972 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406715803 3.52E-06 3.52E-06 mr1972 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251