\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406713801:

Variant ID: vg0406713801 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 6713801
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGCGGACGGCGATCCGGCGACCGGCGGAGGCAGCCTCCAACCTCCAGGCGTTGCCGCTGACCACCTCCACCGGCCACCGCTCCACGGCTCCACAGCTCCA[C/T]
CGAGGAGGCGAGACGACGAAGGTAACTCACTAACTCTCCCTTCATGGCTAATGCCTAATTGGACTAGGAATACAGAAGAATAGAGATTAGGATTTAATTC

Reverse complement sequence

GAATTAAATCCTAATCTCTATTCTTCTGTATTCCTAGTCCAATTAGGCATTAGCCATGAAGGGAGAGTTAGTGAGTTACCTTCGTCGTCTCGCCTCCTCG[G/A]
TGGAGCTGTGGAGCCGTGGAGCGGTGGCCGGTGGAGGTGGTCAGCGGCAACGCCTGGAGGTTGGAGGCTGCCTCCGCCGGTCGCCGGATCGCCGTCCGCC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.70% 27.70% 1.61% 8.93% NA
All Indica  2759 40.10% 44.60% 2.25% 13.05% NA
All Japonica  1512 97.70% 1.80% 0.20% 0.33% NA
Aus  269 84.40% 0.70% 2.23% 12.64% NA
Indica I  595 21.00% 74.30% 0.67% 4.03% NA
Indica II  465 43.70% 23.70% 3.44% 29.25% NA
Indica III  913 48.30% 38.40% 2.41% 10.84% NA
Indica Intermediate  786 42.90% 41.70% 2.54% 12.85% NA
Temperate Japonica  767 99.90% 0.00% 0.00% 0.13% NA
Tropical Japonica  504 95.20% 4.00% 0.40% 0.40% NA
Japonica Intermediate  241 95.90% 2.90% 0.41% 0.83% NA
VI/Aromatic  96 45.80% 33.30% 4.17% 16.67% NA
Intermediate  90 70.00% 21.10% 1.11% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0406713801 C -> DEL N N silent_mutation Average:44.129; most accessible tissue: Minghui63 young leaf, score: 82.368 N N N N
vg0406713801 C -> T LOC_Os04g12180.1 upstream_gene_variant ; 1794.0bp to feature; MODIFIER silent_mutation Average:44.129; most accessible tissue: Minghui63 young leaf, score: 82.368 N N N N
vg0406713801 C -> T LOC_Os04g12190.1 upstream_gene_variant ; 633.0bp to feature; MODIFIER silent_mutation Average:44.129; most accessible tissue: Minghui63 young leaf, score: 82.368 N N N N
vg0406713801 C -> T LOC_Os04g12200.1 downstream_gene_variant ; 4756.0bp to feature; MODIFIER silent_mutation Average:44.129; most accessible tissue: Minghui63 young leaf, score: 82.368 N N N N
vg0406713801 C -> T LOC_Os04g12180-LOC_Os04g12190 intergenic_region ; MODIFIER silent_mutation Average:44.129; most accessible tissue: Minghui63 young leaf, score: 82.368 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0406713801 NA 6.22E-06 mr1382 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406713801 NA 3.65E-07 mr1386 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406713801 NA 7.94E-09 mr1403 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406713801 NA 3.84E-07 mr1403 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406713801 NA 2.95E-08 mr1528 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406713801 NA 1.33E-06 mr1528 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406713801 NA 1.05E-06 mr1573 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406713801 NA 9.61E-06 mr1661 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406713801 NA 1.50E-06 mr1696 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406713801 NA 2.15E-07 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406713801 NA 8.49E-10 mr1846 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406713801 NA 1.11E-07 mr1608_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406713801 NA 3.49E-11 mr1846_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251