Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0406713801:

Variant ID: vg0406713801 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 6713801
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGCGGACGGCGATCCGGCGACCGGCGGAGGCAGCCTCCAACCTCCAGGCGTTGCCGCTGACCACCTCCACCGGCCACCGCTCCACGGCTCCACAGCTCCA[C/T]
CGAGGAGGCGAGACGACGAAGGTAACTCACTAACTCTCCCTTCATGGCTAATGCCTAATTGGACTAGGAATACAGAAGAATAGAGATTAGGATTTAATTC

Reverse complement sequence

GAATTAAATCCTAATCTCTATTCTTCTGTATTCCTAGTCCAATTAGGCATTAGCCATGAAGGGAGAGTTAGTGAGTTACCTTCGTCGTCTCGCCTCCTCG[G/A]
TGGAGCTGTGGAGCCGTGGAGCGGTGGCCGGTGGAGGTGGTCAGCGGCAACGCCTGGAGGTTGGAGGCTGCCTCCGCCGGTCGCCGGATCGCCGTCCGCC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	61.70%	27.70%	1.61%	8.93%	NA
All Indica	2759	40.10%	44.60%	2.25%	13.05%	NA
All Japonica	1512	97.70%	1.80%	0.20%	0.33%	NA
Aus	269	84.40%	0.70%	2.23%	12.64%	NA
Indica I	595	21.00%	74.30%	0.67%	4.03%	NA
Indica II	465	43.70%	23.70%	3.44%	29.25%	NA
Indica III	913	48.30%	38.40%	2.41%	10.84%	NA
Indica Intermediate	786	42.90%	41.70%	2.54%	12.85%	NA
Temperate Japonica	767	99.90%	0.00%	0.00%	0.13%	NA
Tropical Japonica	504	95.20%	4.00%	0.40%	0.40%	NA
Japonica Intermediate	241	95.90%	2.90%	0.41%	0.83%	NA
VI/Aromatic	96	45.80%	33.30%	4.17%	16.67%	NA
Intermediate	90	70.00%	21.10%	1.11%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0406713801	C -> DEL	N	N	silent_mutation	Average:44.129; most accessible tissue: Minghui63 young leaf, score: 82.368	N	N	N	N
vg0406713801	C -> T	LOC_Os04g12180.1	upstream_gene_variant ; 1794.0bp to feature; MODIFIER	silent_mutation	Average:44.129; most accessible tissue: Minghui63 young leaf, score: 82.368	N	N	N	N
vg0406713801	C -> T	LOC_Os04g12190.1	upstream_gene_variant ; 633.0bp to feature; MODIFIER	silent_mutation	Average:44.129; most accessible tissue: Minghui63 young leaf, score: 82.368	N	N	N	N
vg0406713801	C -> T	LOC_Os04g12200.1	downstream_gene_variant ; 4756.0bp to feature; MODIFIER	silent_mutation	Average:44.129; most accessible tissue: Minghui63 young leaf, score: 82.368	N	N	N	N
vg0406713801	C -> T	LOC_Os04g12180-LOC_Os04g12190	intergenic_region ; MODIFIER	silent_mutation	Average:44.129; most accessible tissue: Minghui63 young leaf, score: 82.368	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0406713801	NA	6.22E-06	mr1382	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406713801	NA	3.65E-07	mr1386	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406713801	NA	7.94E-09	mr1403	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406713801	NA	3.84E-07	mr1403	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406713801	NA	2.95E-08	mr1528	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406713801	NA	1.33E-06	mr1528	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406713801	NA	1.05E-06	mr1573	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406713801	NA	9.61E-06	mr1661	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406713801	NA	1.50E-06	mr1696	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406713801	NA	2.15E-07	mr1763	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406713801	NA	8.49E-10	mr1846	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406713801	NA	1.11E-07	mr1608_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406713801	NA	3.49E-11	mr1846_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251