\
| Variant ID: vg0406713801 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 6713801 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GGCGGACGGCGATCCGGCGACCGGCGGAGGCAGCCTCCAACCTCCAGGCGTTGCCGCTGACCACCTCCACCGGCCACCGCTCCACGGCTCCACAGCTCCA[C/T]
CGAGGAGGCGAGACGACGAAGGTAACTCACTAACTCTCCCTTCATGGCTAATGCCTAATTGGACTAGGAATACAGAAGAATAGAGATTAGGATTTAATTC
GAATTAAATCCTAATCTCTATTCTTCTGTATTCCTAGTCCAATTAGGCATTAGCCATGAAGGGAGAGTTAGTGAGTTACCTTCGTCGTCTCGCCTCCTCG[G/A]
TGGAGCTGTGGAGCCGTGGAGCGGTGGCCGGTGGAGGTGGTCAGCGGCAACGCCTGGAGGTTGGAGGCTGCCTCCGCCGGTCGCCGGATCGCCGTCCGCC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.70% | 27.70% | 1.61% | 8.93% | NA |
| All Indica | 2759 | 40.10% | 44.60% | 2.25% | 13.05% | NA |
| All Japonica | 1512 | 97.70% | 1.80% | 0.20% | 0.33% | NA |
| Aus | 269 | 84.40% | 0.70% | 2.23% | 12.64% | NA |
| Indica I | 595 | 21.00% | 74.30% | 0.67% | 4.03% | NA |
| Indica II | 465 | 43.70% | 23.70% | 3.44% | 29.25% | NA |
| Indica III | 913 | 48.30% | 38.40% | 2.41% | 10.84% | NA |
| Indica Intermediate | 786 | 42.90% | 41.70% | 2.54% | 12.85% | NA |
| Temperate Japonica | 767 | 99.90% | 0.00% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 95.20% | 4.00% | 0.40% | 0.40% | NA |
| Japonica Intermediate | 241 | 95.90% | 2.90% | 0.41% | 0.83% | NA |
| VI/Aromatic | 96 | 45.80% | 33.30% | 4.17% | 16.67% | NA |
| Intermediate | 90 | 70.00% | 21.10% | 1.11% | 7.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0406713801 | C -> DEL | N | N | silent_mutation | Average:44.129; most accessible tissue: Minghui63 young leaf, score: 82.368 | N | N | N | N |
| vg0406713801 | C -> T | LOC_Os04g12180.1 | upstream_gene_variant ; 1794.0bp to feature; MODIFIER | silent_mutation | Average:44.129; most accessible tissue: Minghui63 young leaf, score: 82.368 | N | N | N | N |
| vg0406713801 | C -> T | LOC_Os04g12190.1 | upstream_gene_variant ; 633.0bp to feature; MODIFIER | silent_mutation | Average:44.129; most accessible tissue: Minghui63 young leaf, score: 82.368 | N | N | N | N |
| vg0406713801 | C -> T | LOC_Os04g12200.1 | downstream_gene_variant ; 4756.0bp to feature; MODIFIER | silent_mutation | Average:44.129; most accessible tissue: Minghui63 young leaf, score: 82.368 | N | N | N | N |
| vg0406713801 | C -> T | LOC_Os04g12180-LOC_Os04g12190 | intergenic_region ; MODIFIER | silent_mutation | Average:44.129; most accessible tissue: Minghui63 young leaf, score: 82.368 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0406713801 | NA | 6.22E-06 | mr1382 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406713801 | NA | 3.65E-07 | mr1386 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406713801 | NA | 7.94E-09 | mr1403 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406713801 | NA | 3.84E-07 | mr1403 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406713801 | NA | 2.95E-08 | mr1528 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406713801 | NA | 1.33E-06 | mr1528 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406713801 | NA | 1.05E-06 | mr1573 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406713801 | NA | 9.61E-06 | mr1661 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406713801 | NA | 1.50E-06 | mr1696 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406713801 | NA | 2.15E-07 | mr1763 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406713801 | NA | 8.49E-10 | mr1846 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406713801 | NA | 1.11E-07 | mr1608_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406713801 | NA | 3.49E-11 | mr1846_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |