\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406707016:

Variant ID: vg0406707016 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 6707016
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.79, A: 0.21, others allele: 0.00, population size: 66. )

Flanking Sequence (100 bp) in Reference Genome:


TGTAGATCAAGGCGCGCGTTTAACCCGTCCTTTGTCTTCCTGGGAATATTCAACATCAGGCAACCAAACTCTCACACACATTCTTTTCTACATGCATGAG[G/A]
TCAATGCAATGACGGACATCAAGATCTTTCCAGTAAGGTAGCTGCCAAAATATGGATTTTTTCTTCCACATACCCTTCTCCTTTGTCTTGCTACGTTTTC

Reverse complement sequence

GAAAACGTAGCAAGACAAAGGAGAAGGGTATGTGGAAGAAAAAATCCATATTTTGGCAGCTACCTTACTGGAAAGATCTTGATGTCCGTCATTGCATTGA[C/T]
CTCATGCATGTAGAAAAGAATGTGTGTGAGAGTTTGGTTGCCTGATGTTGAATATTCCCAGGAAGACAAAGGACGGGTTAAACGCGCGCCTTGATCTACA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.10% 10.80% 1.35% 22.81% NA
All Indica  2759 51.60% 18.00% 1.74% 28.63% NA
All Japonica  1512 98.70% 0.40% 0.13% 0.79% NA
Aus  269 11.90% 0.00% 4.83% 83.27% NA
Indica I  595 83.90% 6.10% 0.34% 9.75% NA
Indica II  465 31.00% 13.50% 1.29% 54.19% NA
Indica III  913 41.40% 25.60% 3.29% 29.68% NA
Indica Intermediate  786 51.40% 20.70% 1.27% 26.59% NA
Temperate Japonica  767 99.10% 0.30% 0.26% 0.39% NA
Tropical Japonica  504 98.40% 0.80% 0.00% 0.79% NA
Japonica Intermediate  241 97.90% 0.00% 0.00% 2.07% NA
VI/Aromatic  96 64.60% 0.00% 0.00% 35.42% NA
Intermediate  90 71.10% 7.80% 1.11% 20.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0406707016 G -> DEL N N silent_mutation Average:21.511; most accessible tissue: Minghui63 young leaf, score: 42.042 N N N N
vg0406707016 G -> A LOC_Os04g12160.1 downstream_gene_variant ; 2588.0bp to feature; MODIFIER silent_mutation Average:21.511; most accessible tissue: Minghui63 young leaf, score: 42.042 N N N N
vg0406707016 G -> A LOC_Os04g12180.1 downstream_gene_variant ; 2205.0bp to feature; MODIFIER silent_mutation Average:21.511; most accessible tissue: Minghui63 young leaf, score: 42.042 N N N N
vg0406707016 G -> A LOC_Os04g12170.1 intron_variant ; MODIFIER silent_mutation Average:21.511; most accessible tissue: Minghui63 young leaf, score: 42.042 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0406707016 6.76E-06 6.76E-06 mr1054 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406707016 NA 4.01E-06 mr1166 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406707016 NA 1.38E-06 mr1181 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406707016 NA 1.28E-06 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406707016 NA 3.68E-06 mr1233 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406707016 2.27E-06 1.30E-06 mr1286 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406707016 NA 2.85E-07 mr1305 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406707016 NA 2.94E-07 mr1409 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406707016 NA 4.58E-06 mr1426 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406707016 7.25E-06 1.84E-06 mr1537 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406707016 NA 1.69E-06 mr1586 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406707016 NA 4.34E-06 mr1625 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406707016 NA 2.82E-07 mr1649 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406707016 1.98E-07 1.98E-07 mr1687 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406707016 6.87E-06 6.86E-06 mr1777 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406707016 NA 7.51E-06 mr1782 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406707016 1.70E-06 2.38E-06 mr1972 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406707016 2.96E-06 2.96E-06 mr1972 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251