\
| Variant ID: vg0406472365 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 6472365 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.92, A: 0.08, others allele: 0.00, population size: 93. )
TCGTCGTCGGCATGACGTGGAACCACGTCGTCGCCGACGGCAAGGGCATAGCTCAGTTCCTGCGTGCCGTCGGCGAGCTCGCGCGGGGGCTGCCGCGGCC[G/A]
TCCGTCCTGCCGGTGAGCTGCGGCGACGACTCCCTCCCGGAGCTCCCGCCGCTGGTCGCCGCCATGGAGAAGGCGATGCTGACGCAGGAGAGCAAGCAGT
ACTGCTTGCTCTCCTGCGTCAGCATCGCCTTCTCCATGGCGGCGACCAGCGGCGGGAGCTCCGGGAGGGAGTCGTCGCCGCAGCTCACCGGCAGGACGGA[C/T]
GGCCGCGGCAGCCCCCGCGCGAGCTCGCCGACGGCACGCAGGAACTGAGCTATGCCCTTGCCGTCGGCGACGACGTGGTTCCACGTCATGCCGACGACGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 65.10% | 34.90% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 42.70% | 57.30% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 9.40% | 90.60% | 0.00% | 0.00% | NA |
| Indica II | 465 | 53.30% | 46.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 57.30% | 42.70% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 44.70% | 55.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 59.40% | 40.60% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 75.60% | 24.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0406472365 | G -> A | LOC_Os04g11810.1 | synonymous_variant ; p.Pro189Pro; LOW | synonymous_codon | Average:72.179; most accessible tissue: Minghui63 root, score: 83.807 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0406472365 | NA | 2.54E-16 | mr1143 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406472365 | NA | 1.02E-06 | mr1925 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406472365 | NA | 1.37E-06 | mr1045_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406472365 | NA | 3.08E-10 | mr1062_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406472365 | NA | 2.72E-19 | mr1195_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406472365 | NA | 2.19E-06 | mr1358_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406472365 | NA | 2.37E-07 | mr1517_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406472365 | NA | 1.12E-32 | mr1598_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406472365 | NA | 8.51E-07 | mr1655_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406472365 | NA | 2.18E-09 | mr1715_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406472365 | 1.34E-06 | 7.91E-08 | mr1882_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406472365 | NA | 1.73E-07 | mr1882_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406472365 | NA | 3.16E-06 | mr1895_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406472365 | NA | 2.67E-06 | mr1925_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |