\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406390054:

Variant ID: vg0406390054 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 6390054
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:


GTTGTATCTGGTTTTCTGGTTGAAGGACGAAAATCGGATTCGCTGACAAGTTAAGGACCTCAGATGAACTTATTCCTTTAATCGATTTAATCGGTAATTT[A/G]
TTCGATTCCCACGTGAAAATTGAATTTTGTAGGACTAAGAGGAGTTTGCCTTGCAGAGGAGAAAATCAAATTTAAGATCAATTTGGGAAATCCTAGAAAA

Reverse complement sequence

TTTTCTAGGATTTCCCAAATTGATCTTAAATTTGATTTTCTCCTCTGCAAGGCAAACTCCTCTTAGTCCTACAAAATTCAATTTTCACGTGGGAATCGAA[T/C]
AAATTACCGATTAAATCGATTAAAGGAATAAGTTCATCTGAGGTCCTTAACTTGTCAGCGAATCCGATTTTCGTCCTTCAACCAGAAAACCAGATACAAC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.80% 10.30% 0.02% 0.91% NA
All Indica  2759 89.00% 10.90% 0.00% 0.14% NA
All Japonica  1512 97.00% 2.90% 0.00% 0.07% NA
Aus  269 63.20% 36.40% 0.00% 0.37% NA
Indica I  595 92.10% 7.90% 0.00% 0.00% NA
Indica II  465 97.20% 2.80% 0.00% 0.00% NA
Indica III  913 84.40% 15.40% 0.00% 0.11% NA
Indica Intermediate  786 87.00% 12.60% 0.00% 0.38% NA
Temperate Japonica  767 95.70% 4.30% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 95.90% 3.70% 0.00% 0.41% NA
VI/Aromatic  96 30.20% 36.50% 1.04% 32.29% NA
Intermediate  90 82.20% 11.10% 0.00% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0406390054 A -> DEL N N silent_mutation Average:64.984; most accessible tissue: Minghui63 panicle, score: 82.128 N N N N
vg0406390054 A -> G LOC_Os04g11660.1 upstream_gene_variant ; 1119.0bp to feature; MODIFIER silent_mutation Average:64.984; most accessible tissue: Minghui63 panicle, score: 82.128 N N N N
vg0406390054 A -> G LOC_Os04g11660.2 upstream_gene_variant ; 1101.0bp to feature; MODIFIER silent_mutation Average:64.984; most accessible tissue: Minghui63 panicle, score: 82.128 N N N N
vg0406390054 A -> G LOC_Os04g11660-LOC_Os04g11670 intergenic_region ; MODIFIER silent_mutation Average:64.984; most accessible tissue: Minghui63 panicle, score: 82.128 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0406390054 8.42E-06 NA mr1071 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406390054 1.96E-10 1.28E-15 mr1071 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406390054 2.43E-07 7.74E-12 mr1080 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406390054 1.04E-09 2.71E-15 mr1100 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406390054 5.76E-11 6.38E-17 mr1140 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406390054 2.36E-09 1.13E-14 mr1203 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406390054 3.20E-10 5.00E-15 mr1395 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406390054 9.93E-13 4.07E-21 mr1613 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406390054 5.92E-06 NA mr1618 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406390054 3.29E-11 2.88E-16 mr1618 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406390054 1.28E-06 1.36E-10 mr1619 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406390054 3.10E-06 3.10E-06 mr1795 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406390054 4.15E-09 2.42E-20 mr1913 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406390054 8.41E-07 2.78E-09 mr1962 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406390054 1.68E-10 NA mr1071_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406390054 5.49E-19 3.62E-25 mr1071_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406390054 3.43E-09 NA mr1080_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406390054 4.87E-16 4.34E-21 mr1080_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406390054 1.45E-08 NA mr1100_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406390054 1.99E-19 5.88E-28 mr1100_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406390054 4.42E-11 NA mr1203_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406390054 1.40E-18 4.48E-25 mr1203_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406390054 4.72E-14 1.65E-18 mr1402_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406390054 4.68E-11 NA mr1613_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406390054 4.02E-31 7.06E-46 mr1613_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406390054 1.41E-07 NA mr1619_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406390054 1.41E-19 1.01E-23 mr1619_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406390054 5.79E-06 NA mr1795_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406390054 1.03E-19 3.60E-25 mr1795_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406390054 3.06E-08 8.50E-07 mr1888_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406390054 5.57E-08 NA mr1913_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406390054 7.21E-30 1.47E-44 mr1913_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406390054 6.47E-07 NA mr1962_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406390054 1.65E-23 1.35E-33 mr1962_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251