Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0406376847:

Variant ID: vg0406376847 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 6376847
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CGGCCTCTCCTTTTATATTTAGCGTTGTAGGGAATCGGGGGGCGCCTCAATAGGAAATAAATTGGGCGCCACCGATCACGGCACGTTAGTTAATCGGGAA[T/C]
TCGATCGCTGTTATTTCGCGTAGACAACGGGTGGAAAACGGCCTAGCGCGATCTCCTCCCGGTTTTCCAAACCGAGAGATCAATTTTCCCAACAATTCCT

Reverse complement sequence

AGGAATTGTTGGGAAAATTGATCTCTCGGTTTGGAAAACCGGGAGGAGATCGCGCTAGGCCGTTTTCCACCCGTTGTCTACGCGAAATAACAGCGATCGA[A/G]
TTCCCGATTAACTAACGTGCCGTGATCGGTGGCGCCCAATTTATTTCCTATTGAGGCGCCCCCCGATTCCCTACAACGCTAAATATAAAAGGAGAGGCCG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.10%	2.50%	0.68%	2.69%	NA
All Indica	2759	97.00%	0.20%	0.22%	2.65%	NA
All Japonica	1512	89.40%	7.50%	1.32%	1.85%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	88.80%	0.40%	0.65%	10.11%	NA
Indica III	913	98.00%	0.10%	0.22%	1.64%	NA
Indica Intermediate	786	98.20%	0.30%	0.13%	1.40%	NA
Temperate Japonica	767	98.60%	1.20%	0.26%	0.00%	NA
Tropical Japonica	504	79.20%	14.70%	2.18%	3.97%	NA
Japonica Intermediate	241	81.30%	12.40%	2.90%	3.32%	NA
VI/Aromatic	96	72.90%	0.00%	4.17%	22.92%	NA
Intermediate	90	92.20%	1.10%	2.22%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0406376847	T -> C	LOC_Os04g11640.1	upstream_gene_variant ; 1913.0bp to feature; MODIFIER	silent_mutation	Average:46.476; most accessible tissue: Zhenshan97 young leaf, score: 80.325	N	N	N	N
vg0406376847	T -> C	LOC_Os04g11630.1	downstream_gene_variant ; 417.0bp to feature; MODIFIER	silent_mutation	Average:46.476; most accessible tissue: Zhenshan97 young leaf, score: 80.325	N	N	N	N
vg0406376847	T -> C	LOC_Os04g11630-LOC_Os04g11640	intergenic_region ; MODIFIER	silent_mutation	Average:46.476; most accessible tissue: Zhenshan97 young leaf, score: 80.325	N	N	N	N
vg0406376847	T -> DEL	N	N	silent_mutation	Average:46.476; most accessible tissue: Zhenshan97 young leaf, score: 80.325	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0406376847	NA	9.63E-07	mr1213	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406376847	4.89E-07	NA	mr1993_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251