\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406345525:

Variant ID: vg0406345525 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 6345525
Reference Allele: GAlternative Allele: A,T
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:


TTGGATCATGCATATACTCACTGGAAAATGAAACCTCCGTCCAAGTTTTTCTTTCCAAGTCCCGCGGACCAATTGACGGAACCGATCCCAAGCCCTACAT[G/A,T]
TGCAGTTGCAAGCTATGATTAATTAATTATTACCCGAGATCAACATAATAGCAATGGAATCCCCGCGACTTTGGAATAGATGGCATTATATTGCCTGTCT

Reverse complement sequence

AGACAGGCAATATAATGCCATCTATTCCAAAGTCGCGGGGATTCCATTGCTATTATGTTGATCTCGGGTAATAATTAATTAATCATAGCTTGCAACTGCA[C/T,A]
ATGTAGGGCTTGGGATCGGTTCCGTCAATTGGTCCGCGGGACTTGGAAAGAAAAACTTGGACGGAGGTTTCATTTTCCAGTGAGTATATGCATGATCCAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.90% 8.40% 2.77% 0.95% NA
All Indica  2759 88.40% 7.10% 3.81% 0.69% NA
All Japonica  1512 95.20% 2.80% 0.20% 1.72% NA
Aus  269 65.80% 28.30% 5.95% 0.00% NA
Indica I  595 92.40% 6.40% 1.18% 0.00% NA
Indica II  465 92.90% 2.20% 4.95% 0.00% NA
Indica III  913 84.40% 9.00% 4.93% 1.64% NA
Indica Intermediate  786 87.20% 8.50% 3.82% 0.51% NA
Temperate Japonica  767 95.80% 3.90% 0.26% 0.00% NA
Tropical Japonica  504 95.40% 0.40% 0.20% 3.97% NA
Japonica Intermediate  241 92.90% 4.60% 0.00% 2.49% NA
VI/Aromatic  96 26.00% 68.80% 5.21% 0.00% NA
Intermediate  90 81.10% 16.70% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0406345525 G -> DEL N N silent_mutation Average:34.465; most accessible tissue: Zhenshan97 flag leaf, score: 53.034 N N N N
vg0406345525 G -> A LOC_Os04g11570.1 downstream_gene_variant ; 4363.0bp to feature; MODIFIER silent_mutation Average:34.465; most accessible tissue: Zhenshan97 flag leaf, score: 53.034 N N N N
vg0406345525 G -> A LOC_Os04g11590.1 downstream_gene_variant ; 1030.0bp to feature; MODIFIER silent_mutation Average:34.465; most accessible tissue: Zhenshan97 flag leaf, score: 53.034 N N N N
vg0406345525 G -> A LOC_Os04g11580.1 intron_variant ; MODIFIER silent_mutation Average:34.465; most accessible tissue: Zhenshan97 flag leaf, score: 53.034 N N N N
vg0406345525 G -> T LOC_Os04g11570.1 downstream_gene_variant ; 4363.0bp to feature; MODIFIER N Average:34.465; most accessible tissue: Zhenshan97 flag leaf, score: 53.034 N N N N
vg0406345525 G -> T LOC_Os04g11590.1 downstream_gene_variant ; 1030.0bp to feature; MODIFIER N Average:34.465; most accessible tissue: Zhenshan97 flag leaf, score: 53.034 N N N N
vg0406345525 G -> T LOC_Os04g11580.1 intron_variant ; MODIFIER N Average:34.465; most accessible tissue: Zhenshan97 flag leaf, score: 53.034 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0406345525 2.06E-07 6.53E-12 mr1071 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406345525 NA 3.04E-08 mr1080 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406345525 1.04E-08 1.05E-13 mr1100 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406345525 8.40E-08 4.72E-13 mr1140 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406345525 1.98E-06 1.23E-10 mr1203 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406345525 1.42E-08 5.48E-13 mr1395 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406345525 5.63E-12 1.18E-19 mr1613 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406345525 6.95E-07 5.04E-11 mr1618 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406345525 5.46E-07 1.07E-10 mr1619 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406345525 1.15E-06 1.15E-06 mr1795 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406345525 1.60E-08 8.50E-18 mr1913 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406345525 NA 2.12E-07 mr1962 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406345525 4.39E-08 NA mr1071_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406345525 1.54E-10 2.02E-16 mr1071_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406345525 3.84E-06 NA mr1080_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406345525 1.52E-08 7.39E-14 mr1080_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406345525 4.53E-07 NA mr1100_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406345525 2.09E-11 6.08E-18 mr1100_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406345525 7.11E-08 NA mr1203_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406345525 6.27E-11 3.15E-17 mr1203_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406345525 1.13E-08 5.88E-13 mr1402_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406345525 2.26E-09 NA mr1613_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406345525 2.60E-15 3.26E-26 mr1613_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406345525 4.53E-06 NA mr1619_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406345525 5.20E-10 5.41E-14 mr1619_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406345525 1.37E-12 1.35E-18 mr1795_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406345525 6.67E-06 NA mr1888_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406345525 1.70E-22 2.12E-32 mr1913_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406345525 1.71E-06 NA mr1962_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406345525 7.50E-10 5.34E-17 mr1962_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251