\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406344978:

Variant ID: vg0406344978 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 6344978
Reference Allele: CAlternative Allele: T,G
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 78. )

Flanking Sequence (100 bp) in Reference Genome:


AACACTAAAGTAAATGTGTACATATAAATGTGTACATATATAAATATATATATACATGCATATATAGTACAATTCATTTGCTCGCTAGCTATAGCTACGA[C/T,G]
TTCGACGTCGGCGTTATGTCAGAGGAGGAAGGACCGACGTTATGAATTGTTGATCCATCGTAGTAGAATTCACCATCGGGATTAAGGACTTATTCGTTGA

Reverse complement sequence

TCAACGAATAAGTCCTTAATCCCGATGGTGAATTCTACTACGATGGATCAACAATTCATAACGTCGGTCCTTCCTCCTCTGACATAACGCCGACGTCGAA[G/A,C]
TCGTAGCTATAGCTAGCGAGCAAATGAATTGTACTATATATGCATGTATATATATATTTATATATGTACACATTTATATGTACACATTTACTTTAGTGTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.50% 10.20% 1.29% 2.96% NA
All Indica  2759 84.80% 10.90% 1.74% 2.50% NA
All Japonica  1512 95.30% 2.80% 0.07% 1.85% NA
Aus  269 48.00% 34.90% 3.35% 13.75% NA
Indica I  595 91.80% 8.10% 0.00% 0.17% NA
Indica II  465 83.90% 3.00% 5.59% 7.53% NA
Indica III  913 82.40% 15.20% 1.20% 1.20% NA
Indica Intermediate  786 83.00% 12.80% 1.40% 2.80% NA
Temperate Japonica  767 96.00% 4.00% 0.00% 0.00% NA
Tropical Japonica  504 95.20% 0.40% 0.20% 4.17% NA
Japonica Intermediate  241 93.40% 3.70% 0.00% 2.90% NA
VI/Aromatic  96 60.40% 36.50% 0.00% 3.12% NA
Intermediate  90 83.30% 10.00% 3.33% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0406344978 C -> DEL N N silent_mutation Average:20.029; most accessible tissue: Callus, score: 26.588 N N N N
vg0406344978 C -> G LOC_Os04g11570.1 downstream_gene_variant ; 3816.0bp to feature; MODIFIER N Average:20.029; most accessible tissue: Callus, score: 26.588 N N N N
vg0406344978 C -> G LOC_Os04g11580.1 downstream_gene_variant ; 90.0bp to feature; MODIFIER N Average:20.029; most accessible tissue: Callus, score: 26.588 N N N N
vg0406344978 C -> G LOC_Os04g11590.1 downstream_gene_variant ; 1577.0bp to feature; MODIFIER N Average:20.029; most accessible tissue: Callus, score: 26.588 N N N N
vg0406344978 C -> G LOC_Os04g11570-LOC_Os04g11580 intergenic_region ; MODIFIER N Average:20.029; most accessible tissue: Callus, score: 26.588 N N N N
vg0406344978 C -> T LOC_Os04g11570.1 downstream_gene_variant ; 3816.0bp to feature; MODIFIER silent_mutation Average:20.029; most accessible tissue: Callus, score: 26.588 N N N N
vg0406344978 C -> T LOC_Os04g11580.1 downstream_gene_variant ; 90.0bp to feature; MODIFIER silent_mutation Average:20.029; most accessible tissue: Callus, score: 26.588 N N N N
vg0406344978 C -> T LOC_Os04g11590.1 downstream_gene_variant ; 1577.0bp to feature; MODIFIER silent_mutation Average:20.029; most accessible tissue: Callus, score: 26.588 N N N N
vg0406344978 C -> T LOC_Os04g11570-LOC_Os04g11580 intergenic_region ; MODIFIER silent_mutation Average:20.029; most accessible tissue: Callus, score: 26.588 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0406344978 1.29E-06 NA mr1071 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406344978 1.73E-11 1.51E-16 mr1071 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406344978 2.17E-08 4.82E-13 mr1080 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406344978 2.36E-11 4.83E-17 mr1100 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406344978 1.70E-07 NA mr1140 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406344978 2.33E-12 4.42E-18 mr1140 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406344978 6.67E-07 NA mr1203 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406344978 4.95E-11 2.70E-16 mr1203 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406344978 1.21E-07 NA mr1395 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406344978 1.81E-11 2.15E-16 mr1395 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406344978 7.60E-06 NA mr1613 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406344978 3.10E-16 1.11E-24 mr1613 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406344978 5.21E-08 NA mr1618 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406344978 7.55E-12 1.07E-16 mr1618 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406344978 4.04E-09 4.45E-13 mr1619 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406344978 6.24E-07 6.24E-07 mr1795 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406344978 2.17E-11 1.70E-23 mr1913 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406344978 6.23E-08 1.99E-10 mr1962 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406344978 1.49E-07 NA mr1071_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406344978 2.56E-15 1.21E-20 mr1071_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406344978 4.34E-07 NA mr1080_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406344978 1.37E-12 3.28E-17 mr1080_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406344978 2.66E-06 NA mr1100_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406344978 5.77E-15 7.72E-23 mr1100_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406344978 1.46E-08 NA mr1203_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406344978 9.89E-16 4.43E-21 mr1203_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406344978 6.51E-10 5.75E-14 mr1402_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406344978 2.78E-07 NA mr1613_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406344978 4.83E-23 1.01E-35 mr1613_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406344978 3.08E-14 3.65E-18 mr1619_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406344978 1.30E-11 5.02E-17 mr1795_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406344978 3.84E-06 NA mr1888_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406344978 5.87E-07 NA mr1913_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406344978 7.67E-27 8.53E-40 mr1913_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406344978 1.85E-13 1.80E-22 mr1962_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251