Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0406344978:

Variant ID: vg0406344978 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 6344978
Reference Allele: C	Alternative Allele: T,G
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 78. )

Flanking Sequence (100 bp) in Reference Genome:

AACACTAAAGTAAATGTGTACATATAAATGTGTACATATATAAATATATATATACATGCATATATAGTACAATTCATTTGCTCGCTAGCTATAGCTACGA[C/T,G]
TTCGACGTCGGCGTTATGTCAGAGGAGGAAGGACCGACGTTATGAATTGTTGATCCATCGTAGTAGAATTCACCATCGGGATTAAGGACTTATTCGTTGA

Reverse complement sequence

TCAACGAATAAGTCCTTAATCCCGATGGTGAATTCTACTACGATGGATCAACAATTCATAACGTCGGTCCTTCCTCCTCTGACATAACGCCGACGTCGAA[G/A,C]
TCGTAGCTATAGCTAGCGAGCAAATGAATTGTACTATATATGCATGTATATATATATTTATATATGTACACATTTATATGTACACATTTACTTTAGTGTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	85.50%	10.20%	1.29%	2.96%	NA
All Indica	2759	84.80%	10.90%	1.74%	2.50%	NA
All Japonica	1512	95.30%	2.80%	0.07%	1.85%	NA
Aus	269	48.00%	34.90%	3.35%	13.75%	NA
Indica I	595	91.80%	8.10%	0.00%	0.17%	NA
Indica II	465	83.90%	3.00%	5.59%	7.53%	NA
Indica III	913	82.40%	15.20%	1.20%	1.20%	NA
Indica Intermediate	786	83.00%	12.80%	1.40%	2.80%	NA
Temperate Japonica	767	96.00%	4.00%	0.00%	0.00%	NA
Tropical Japonica	504	95.20%	0.40%	0.20%	4.17%	NA
Japonica Intermediate	241	93.40%	3.70%	0.00%	2.90%	NA
VI/Aromatic	96	60.40%	36.50%	0.00%	3.12%	NA
Intermediate	90	83.30%	10.00%	3.33%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0406344978	C -> DEL	N	N	silent_mutation	Average:20.029; most accessible tissue: Callus, score: 26.588	N	N	N	N
vg0406344978	C -> G	LOC_Os04g11570.1	downstream_gene_variant ; 3816.0bp to feature; MODIFIER	N	Average:20.029; most accessible tissue: Callus, score: 26.588	N	N	N	N
vg0406344978	C -> G	LOC_Os04g11580.1	downstream_gene_variant ; 90.0bp to feature; MODIFIER	N	Average:20.029; most accessible tissue: Callus, score: 26.588	N	N	N	N
vg0406344978	C -> G	LOC_Os04g11590.1	downstream_gene_variant ; 1577.0bp to feature; MODIFIER	N	Average:20.029; most accessible tissue: Callus, score: 26.588	N	N	N	N
vg0406344978	C -> G	LOC_Os04g11570-LOC_Os04g11580	intergenic_region ; MODIFIER	N	Average:20.029; most accessible tissue: Callus, score: 26.588	N	N	N	N
vg0406344978	C -> T	LOC_Os04g11570.1	downstream_gene_variant ; 3816.0bp to feature; MODIFIER	silent_mutation	Average:20.029; most accessible tissue: Callus, score: 26.588	N	N	N	N
vg0406344978	C -> T	LOC_Os04g11580.1	downstream_gene_variant ; 90.0bp to feature; MODIFIER	silent_mutation	Average:20.029; most accessible tissue: Callus, score: 26.588	N	N	N	N
vg0406344978	C -> T	LOC_Os04g11590.1	downstream_gene_variant ; 1577.0bp to feature; MODIFIER	silent_mutation	Average:20.029; most accessible tissue: Callus, score: 26.588	N	N	N	N
vg0406344978	C -> T	LOC_Os04g11570-LOC_Os04g11580	intergenic_region ; MODIFIER	silent_mutation	Average:20.029; most accessible tissue: Callus, score: 26.588	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0406344978	1.29E-06	NA	mr1071	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406344978	1.73E-11	1.51E-16	mr1071	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406344978	2.17E-08	4.82E-13	mr1080	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406344978	2.36E-11	4.83E-17	mr1100	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406344978	1.70E-07	NA	mr1140	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406344978	2.33E-12	4.42E-18	mr1140	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406344978	6.67E-07	NA	mr1203	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406344978	4.95E-11	2.70E-16	mr1203	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406344978	1.21E-07	NA	mr1395	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406344978	1.81E-11	2.15E-16	mr1395	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406344978	7.60E-06	NA	mr1613	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406344978	3.10E-16	1.11E-24	mr1613	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406344978	5.21E-08	NA	mr1618	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406344978	7.55E-12	1.07E-16	mr1618	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406344978	4.04E-09	4.45E-13	mr1619	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406344978	6.24E-07	6.24E-07	mr1795	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406344978	2.17E-11	1.70E-23	mr1913	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406344978	6.23E-08	1.99E-10	mr1962	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406344978	1.49E-07	NA	mr1071_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406344978	2.56E-15	1.21E-20	mr1071_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406344978	4.34E-07	NA	mr1080_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406344978	1.37E-12	3.28E-17	mr1080_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406344978	2.66E-06	NA	mr1100_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406344978	5.77E-15	7.72E-23	mr1100_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406344978	1.46E-08	NA	mr1203_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406344978	9.89E-16	4.43E-21	mr1203_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406344978	6.51E-10	5.75E-14	mr1402_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406344978	2.78E-07	NA	mr1613_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406344978	4.83E-23	1.01E-35	mr1613_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406344978	3.08E-14	3.65E-18	mr1619_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406344978	1.30E-11	5.02E-17	mr1795_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406344978	3.84E-06	NA	mr1888_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406344978	5.87E-07	NA	mr1913_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406344978	7.67E-27	8.53E-40	mr1913_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406344978	1.85E-13	1.80E-22	mr1962_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251