\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406192421:

Variant ID: vg0406192421 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 6192421
Reference Allele: GAlternative Allele: C
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CATCAATTTCAACTATTTGCAGCGGAAGATCTATATAAAATTCATATGAACAGTAGCAATTCTGTTATTTACACTCTGTAAAAAAATACCACTCTGGTTC[G/C]
AATTTTAAACAGAGGTAAAACATAAAAAAAATTCAAATTCTATTGAAAAATTGCATGAAAAATGACAAAATAAAAAGAAAAGGGGCTACTGTTCTTCTCT

Reverse complement sequence

AGAGAAGAACAGTAGCCCCTTTTCTTTTTATTTTGTCATTTTTCATGCAATTTTTCAATAGAATTTGAATTTTTTTTATGTTTTACCTCTGTTTAAAATT[C/G]
GAACCAGAGTGGTATTTTTTTACAGAGTGTAAATAACAGAATTGCTACTGTTCATATGAATTTTATATAGATCTTCCGCTGCAAATAGTTGAAATTGATG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.00% 3.00% 1.48% 4.49% NA
All Indica  2759 91.80% 0.10% 1.20% 6.89% NA
All Japonica  1512 88.20% 8.70% 2.18% 0.93% NA
Aus  269 98.10% 0.00% 0.74% 1.12% NA
Indica I  595 96.60% 0.00% 1.34% 2.02% NA
Indica II  465 89.20% 0.40% 1.29% 9.03% NA
Indica III  913 91.20% 0.00% 0.22% 8.54% NA
Indica Intermediate  786 90.30% 0.10% 2.16% 7.38% NA
Temperate Japonica  767 98.00% 0.40% 1.43% 0.13% NA
Tropical Japonica  504 69.40% 24.40% 3.77% 2.38% NA
Japonica Intermediate  241 95.90% 2.50% 1.24% 0.41% NA
VI/Aromatic  96 92.70% 5.20% 0.00% 2.08% NA
Intermediate  90 92.20% 2.20% 2.22% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0406192421 G -> C LOC_Os04g11340.1 upstream_gene_variant ; 541.0bp to feature; MODIFIER silent_mutation Average:23.918; most accessible tissue: Zhenshan97 flag leaf, score: 64.768 N N N N
vg0406192421 G -> C LOC_Os04g11350.1 downstream_gene_variant ; 1273.0bp to feature; MODIFIER silent_mutation Average:23.918; most accessible tissue: Zhenshan97 flag leaf, score: 64.768 N N N N
vg0406192421 G -> C LOC_Os04g11340-LOC_Os04g11350 intergenic_region ; MODIFIER silent_mutation Average:23.918; most accessible tissue: Zhenshan97 flag leaf, score: 64.768 N N N N
vg0406192421 G -> DEL N N silent_mutation Average:23.918; most accessible tissue: Zhenshan97 flag leaf, score: 64.768 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0406192421 6.77E-09 5.76E-12 mr1076 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406192421 8.48E-06 2.31E-10 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406192421 7.13E-07 1.27E-10 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406192421 7.35E-07 7.35E-07 mr1085 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406192421 NA 3.82E-06 mr1086 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406192421 NA 3.77E-06 mr1103 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406192421 2.58E-07 2.58E-07 mr1145 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406192421 8.43E-07 8.43E-07 mr1204 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406192421 NA 4.59E-09 mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406192421 3.41E-06 2.04E-07 mr1227 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406192421 3.17E-06 1.35E-08 mr1408 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406192421 NA 3.05E-07 mr1411 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406192421 2.12E-07 2.12E-07 mr1436 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406192421 NA 1.07E-07 mr1560 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406192421 NA 1.79E-07 mr1878 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406192421 NA 1.79E-07 mr1949 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406192421 NA 3.12E-07 mr1082_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406192421 NA 8.81E-08 mr1083_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406192421 NA 5.08E-07 mr1103_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406192421 2.84E-06 4.34E-08 mr1104_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406192421 NA 9.22E-07 mr1107_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406192421 1.11E-06 2.41E-10 mr1226_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406192421 NA 3.67E-06 mr1408_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251