Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406192421:

Variant ID: vg0406192421 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 6192421
Reference Allele: G	Alternative Allele: C
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CATCAATTTCAACTATTTGCAGCGGAAGATCTATATAAAATTCATATGAACAGTAGCAATTCTGTTATTTACACTCTGTAAAAAAATACCACTCTGGTTC[G/C]
AATTTTAAACAGAGGTAAAACATAAAAAAAATTCAAATTCTATTGAAAAATTGCATGAAAAATGACAAAATAAAAAGAAAAGGGGCTACTGTTCTTCTCT

Reverse complement sequence

AGAGAAGAACAGTAGCCCCTTTTCTTTTTATTTTGTCATTTTTCATGCAATTTTTCAATAGAATTTGAATTTTTTTTATGTTTTACCTCTGTTTAAAATT[C/G]
GAACCAGAGTGGTATTTTTTTACAGAGTGTAAATAACAGAATTGCTACTGTTCATATGAATTTTATATAGATCTTCCGCTGCAAATAGTTGAAATTGATG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.00%	3.00%	1.48%	4.49%	NA
All Indica	2759	91.80%	0.10%	1.20%	6.89%	NA
All Japonica	1512	88.20%	8.70%	2.18%	0.93%	NA
Aus	269	98.10%	0.00%	0.74%	1.12%	NA
Indica I	595	96.60%	0.00%	1.34%	2.02%	NA
Indica II	465	89.20%	0.40%	1.29%	9.03%	NA
Indica III	913	91.20%	0.00%	0.22%	8.54%	NA
Indica Intermediate	786	90.30%	0.10%	2.16%	7.38%	NA
Temperate Japonica	767	98.00%	0.40%	1.43%	0.13%	NA
Tropical Japonica	504	69.40%	24.40%	3.77%	2.38%	NA
Japonica Intermediate	241	95.90%	2.50%	1.24%	0.41%	NA
VI/Aromatic	96	92.70%	5.20%	0.00%	2.08%	NA
Intermediate	90	92.20%	2.20%	2.22%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0406192421	G -> C	LOC_Os04g11340.1	upstream_gene_variant ; 541.0bp to feature; MODIFIER	silent_mutation	Average:23.918; most accessible tissue: Zhenshan97 flag leaf, score: 64.768	N	N	N	N
vg0406192421	G -> C	LOC_Os04g11350.1	downstream_gene_variant ; 1273.0bp to feature; MODIFIER	silent_mutation	Average:23.918; most accessible tissue: Zhenshan97 flag leaf, score: 64.768	N	N	N	N
vg0406192421	G -> C	LOC_Os04g11340-LOC_Os04g11350	intergenic_region ; MODIFIER	silent_mutation	Average:23.918; most accessible tissue: Zhenshan97 flag leaf, score: 64.768	N	N	N	N
vg0406192421	G -> DEL	N	N	silent_mutation	Average:23.918; most accessible tissue: Zhenshan97 flag leaf, score: 64.768	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0406192421	6.77E-09	5.76E-12	mr1076	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406192421	8.48E-06	2.31E-10	mr1082	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406192421	7.13E-07	1.27E-10	mr1083	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406192421	7.35E-07	7.35E-07	mr1085	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406192421	NA	3.82E-06	mr1086	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406192421	NA	3.77E-06	mr1103	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406192421	2.58E-07	2.58E-07	mr1145	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406192421	8.43E-07	8.43E-07	mr1204	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406192421	NA	4.59E-09	mr1226	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406192421	3.41E-06	2.04E-07	mr1227	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406192421	3.17E-06	1.35E-08	mr1408	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406192421	NA	3.05E-07	mr1411	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406192421	2.12E-07	2.12E-07	mr1436	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406192421	NA	1.07E-07	mr1560	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406192421	NA	1.79E-07	mr1878	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406192421	NA	1.79E-07	mr1949	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406192421	NA	3.12E-07	mr1082_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406192421	NA	8.81E-08	mr1083_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406192421	NA	5.08E-07	mr1103_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406192421	2.84E-06	4.34E-08	mr1104_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406192421	NA	9.22E-07	mr1107_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406192421	1.11E-06	2.41E-10	mr1226_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406192421	NA	3.67E-06	mr1408_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251