\
| Variant ID: vg0406181895 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 6181895 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AACGACGGTTCTGTCCACCATCCATTGTGATCCCAAGGATAGCTTCCCGCCATTGATTCGTCATGGTTTCTGAGGATGTCCACCTTCCCGCCTCTCAGGA[T/A]
GTGGCTCCAACAGCATAAAATTCATCATGCAATAACCCCTCCCACACAAGTTAAGAATTTAGAGTCTAGCCAAGTGTAATACATGTCCCGGTGCTCAATA
TATTGAGCACCGGGACATGTATTACACTTGGCTAGACTCTAAATTCTTAACTTGTGTGGGAGGGGTTATTGCATGATGAATTTTATGCTGTTGGAGCCAC[A/T]
TCCTGAGAGGCGGGAAGGTGGACATCCTCAGAAACCATGACGAATCAATGGCGGGAAGCTATCCTTGGGATCACAATGGATGGTGGACAGAACCGTCGTT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 32.90% | 2.30% | 24.80% | 39.97% | NA |
| All Indica | 2759 | 6.30% | 0.20% | 36.72% | 56.80% | NA |
| All Japonica | 1512 | 87.80% | 6.60% | 1.72% | 3.90% | NA |
| Aus | 269 | 2.20% | 0.00% | 40.15% | 57.62% | NA |
| Indica I | 595 | 4.40% | 0.20% | 22.69% | 72.77% | NA |
| Indica II | 465 | 8.20% | 0.20% | 32.90% | 58.71% | NA |
| Indica III | 913 | 3.10% | 0.10% | 49.62% | 47.21% | NA |
| Indica Intermediate | 786 | 10.40% | 0.30% | 34.61% | 54.71% | NA |
| Temperate Japonica | 767 | 84.60% | 9.00% | 2.09% | 4.30% | NA |
| Tropical Japonica | 504 | 92.50% | 3.40% | 1.19% | 2.98% | NA |
| Japonica Intermediate | 241 | 88.00% | 5.80% | 1.66% | 4.56% | NA |
| VI/Aromatic | 96 | 7.30% | 5.20% | 9.38% | 78.12% | NA |
| Intermediate | 90 | 44.40% | 1.10% | 17.78% | 36.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0406181895 | T -> DEL | N | N | silent_mutation | Average:4.954; most accessible tissue: Callus, score: 9.827 | N | N | N | N |
| vg0406181895 | T -> A | LOC_Os04g11310.1 | upstream_gene_variant ; 2429.0bp to feature; MODIFIER | silent_mutation | Average:4.954; most accessible tissue: Callus, score: 9.827 | N | N | N | N |
| vg0406181895 | T -> A | LOC_Os04g11320.1 | upstream_gene_variant ; 853.0bp to feature; MODIFIER | silent_mutation | Average:4.954; most accessible tissue: Callus, score: 9.827 | N | N | N | N |
| vg0406181895 | T -> A | LOC_Os04g11330.1 | downstream_gene_variant ; 2528.0bp to feature; MODIFIER | silent_mutation | Average:4.954; most accessible tissue: Callus, score: 9.827 | N | N | N | N |
| vg0406181895 | T -> A | LOC_Os04g11320-LOC_Os04g11330 | intergenic_region ; MODIFIER | silent_mutation | Average:4.954; most accessible tissue: Callus, score: 9.827 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0406181895 | NA | 3.12E-06 | mr1549_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406181895 | 2.77E-06 | NA | mr1550_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406181895 | NA | 2.18E-06 | mr1550_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406181895 | 1.44E-07 | NA | mr1757_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406181895 | NA | 1.82E-06 | mr1757_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |