\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406154461:

Variant ID: vg0406154461 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 6154461
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


ACATGTTAAAAATATCCACATGTACTGTTTATGCTTGTTTTTGTACTGTTTTGTTGATTTTTGTTTAATTGCTTTAGTTTCCGACGTTCCGGAGGAGAGC[C/G]
TTCCCGTTGAGGAAGGTTCCGAAGCGTTTGCGGAAGCCCAAGGCAAGTCACACAGATCCCAAACAACCCTTTGAGCATGTTGAACCCGTTTAAAGCTATT

Reverse complement sequence

AATAGCTTTAAACGGGTTCAACATGCTCAAAGGGTTGTTTGGGATCTGTGTGACTTGCCTTGGGCTTCCGCAAACGCTTCGGAACCTTCCTCAACGGGAA[G/C]
GCTCTCCTCCGGAACGTCGGAAACTAAAGCAATTAAACAAAAATCAACAAAACAGTACAAAAACAAGCATAAACAGTACATGTGGATATTTTTAACATGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 38.30% 0.20% 52.96% 8.55% NA
All Indica  2759 11.60% 0.00% 76.84% 11.53% NA
All Japonica  1512 94.10% 0.60% 3.11% 2.18% NA
Aus  269 3.30% 0.00% 89.96% 6.69% NA
Indica I  595 9.20% 0.00% 62.86% 27.90% NA
Indica II  465 23.00% 0.00% 68.17% 8.82% NA
Indica III  913 5.30% 0.00% 91.24% 3.50% NA
Indica Intermediate  786 14.00% 0.10% 75.83% 10.05% NA
Temperate Japonica  767 91.40% 1.20% 4.04% 3.39% NA
Tropical Japonica  504 97.80% 0.00% 1.59% 0.60% NA
Japonica Intermediate  241 95.00% 0.00% 3.32% 1.66% NA
VI/Aromatic  96 16.70% 0.00% 53.12% 30.21% NA
Intermediate  90 45.60% 0.00% 47.78% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0406154461 C -> DEL N N silent_mutation Average:50.827; most accessible tissue: Minghui63 panicle, score: 70.194 N N N N
vg0406154461 C -> G LOC_Os04g11270.1 upstream_gene_variant ; 4993.0bp to feature; MODIFIER silent_mutation Average:50.827; most accessible tissue: Minghui63 panicle, score: 70.194 N N N N
vg0406154461 C -> G LOC_Os04g11260.1 downstream_gene_variant ; 1023.0bp to feature; MODIFIER silent_mutation Average:50.827; most accessible tissue: Minghui63 panicle, score: 70.194 N N N N
vg0406154461 C -> G LOC_Os04g11250-LOC_Os04g11260 intergenic_region ; MODIFIER silent_mutation Average:50.827; most accessible tissue: Minghui63 panicle, score: 70.194 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0406154461 NA 2.24E-13 mr1035 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406154461 NA 4.22E-06 mr1140 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406154461 NA 9.30E-10 mr1379 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406154461 NA 1.10E-06 mr1395 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406154461 NA 3.23E-16 mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406154461 NA 2.76E-07 mr1554 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406154461 NA 6.60E-18 mr1566 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406154461 NA 5.41E-11 mr1609 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406154461 NA 5.67E-07 mr1618 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406154461 NA 2.93E-67 mr1619 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406154461 NA 4.79E-12 mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406154461 NA 4.55E-26 mr1631 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406154461 NA 3.09E-10 mr1663 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406154461 NA 1.04E-06 mr1761 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406154461 NA 1.12E-19 mr1913 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406154461 NA 1.97E-14 mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406154461 NA 1.56E-08 mr1172_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406154461 NA 1.61E-07 mr1399_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406154461 NA 8.60E-30 mr1631_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406154461 NA 8.00E-31 mr1913_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406154461 NA 3.99E-15 mr1950_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251