\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406056639:

Variant ID: vg0406056639 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 6056639
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTAGGAATACTACTATCGTAAGTAATTTATTTACTAAGTGAAGAGTTGAGAACGACCTGAGACTCTGAGAGTGATTCATTTACTGAGAGGAGGAACCAAA[T/C]
TAGACTCTCAGAGTGATTCATTTACTGAGAGAAGGAACCAAATTGAGAAGGGCCGAAAATAACCTCGGAGTAATCCATTTACTGAGGGAAGGAATCAATT

Reverse complement sequence

AATTGATTCCTTCCCTCAGTAAATGGATTACTCCGAGGTTATTTTCGGCCCTTCTCAATTTGGTTCCTTCTCTCAGTAAATGAATCACTCTGAGAGTCTA[A/G]
TTTGGTTCCTCCTCTCAGTAAATGAATCACTCTCAGAGTCTCAGGTCGTTCTCAACTCTTCACTTAGTAAATAAATTACTTACGATAGTAGTATTCCTAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.40% 12.90% 7.72% 0.00% NA
All Indica  2759 81.00% 9.40% 9.57% 0.00% NA
All Japonica  1512 80.30% 18.20% 1.52% 0.00% NA
Aus  269 66.20% 13.40% 20.45% 0.00% NA
Indica I  595 80.80% 8.40% 10.76% 0.00% NA
Indica II  465 83.20% 8.00% 8.82% 0.00% NA
Indica III  913 83.70% 9.50% 6.79% 0.00% NA
Indica Intermediate  786 76.70% 10.90% 12.34% 0.00% NA
Temperate Japonica  767 95.30% 3.50% 1.17% 0.00% NA
Tropical Japonica  504 52.60% 45.40% 1.98% 0.00% NA
Japonica Intermediate  241 90.50% 7.90% 1.66% 0.00% NA
VI/Aromatic  96 58.30% 20.80% 20.83% 0.00% NA
Intermediate  90 77.80% 18.90% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0406056639 T -> C LOC_Os04g11130.1 upstream_gene_variant ; 1786.0bp to feature; MODIFIER silent_mutation Average:15.998; most accessible tissue: Callus, score: 30.809 N N N N
vg0406056639 T -> C LOC_Os04g11120.1 downstream_gene_variant ; 3246.0bp to feature; MODIFIER silent_mutation Average:15.998; most accessible tissue: Callus, score: 30.809 N N N N
vg0406056639 T -> C LOC_Os04g11140.1 downstream_gene_variant ; 2879.0bp to feature; MODIFIER silent_mutation Average:15.998; most accessible tissue: Callus, score: 30.809 N N N N
vg0406056639 T -> C LOC_Os04g11130-LOC_Os04g11140 intergenic_region ; MODIFIER silent_mutation Average:15.998; most accessible tissue: Callus, score: 30.809 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0406056639 NA 4.25E-06 mr1100 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406056639 NA 9.02E-06 mr1227 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406056639 7.68E-06 4.58E-07 mr1613 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406056639 NA 7.50E-06 mr1619 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406056639 NA 4.40E-06 mr1913 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406056639 2.62E-08 3.46E-08 mr1071_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406056639 4.60E-08 1.11E-08 mr1080_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406056639 2.14E-07 5.43E-10 mr1100_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406056639 1.55E-08 2.57E-08 mr1203_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406056639 4.01E-07 6.52E-08 mr1402_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406056639 1.20E-08 1.50E-09 mr1613_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406056639 6.13E-08 2.75E-08 mr1619_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406056639 NA 1.57E-06 mr1795_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406056639 1.96E-06 NA mr1888_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406056639 NA 1.04E-06 mr1896_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406056639 1.66E-09 2.90E-11 mr1913_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406056639 5.68E-08 1.30E-10 mr1962_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251