Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406056639:

Variant ID: vg0406056639 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 6056639
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTAGGAATACTACTATCGTAAGTAATTTATTTACTAAGTGAAGAGTTGAGAACGACCTGAGACTCTGAGAGTGATTCATTTACTGAGAGGAGGAACCAAA[T/C]
TAGACTCTCAGAGTGATTCATTTACTGAGAGAAGGAACCAAATTGAGAAGGGCCGAAAATAACCTCGGAGTAATCCATTTACTGAGGGAAGGAATCAATT

Reverse complement sequence

AATTGATTCCTTCCCTCAGTAAATGGATTACTCCGAGGTTATTTTCGGCCCTTCTCAATTTGGTTCCTTCTCTCAGTAAATGAATCACTCTGAGAGTCTA[A/G]
TTTGGTTCCTCCTCTCAGTAAATGAATCACTCTCAGAGTCTCAGGTCGTTCTCAACTCTTCACTTAGTAAATAAATTACTTACGATAGTAGTATTCCTAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	79.40%	12.90%	7.72%	0.00%	NA
All Indica	2759	81.00%	9.40%	9.57%	0.00%	NA
All Japonica	1512	80.30%	18.20%	1.52%	0.00%	NA
Aus	269	66.20%	13.40%	20.45%	0.00%	NA
Indica I	595	80.80%	8.40%	10.76%	0.00%	NA
Indica II	465	83.20%	8.00%	8.82%	0.00%	NA
Indica III	913	83.70%	9.50%	6.79%	0.00%	NA
Indica Intermediate	786	76.70%	10.90%	12.34%	0.00%	NA
Temperate Japonica	767	95.30%	3.50%	1.17%	0.00%	NA
Tropical Japonica	504	52.60%	45.40%	1.98%	0.00%	NA
Japonica Intermediate	241	90.50%	7.90%	1.66%	0.00%	NA
VI/Aromatic	96	58.30%	20.80%	20.83%	0.00%	NA
Intermediate	90	77.80%	18.90%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0406056639	T -> C	LOC_Os04g11130.1	upstream_gene_variant ; 1786.0bp to feature; MODIFIER	silent_mutation	Average:15.998; most accessible tissue: Callus, score: 30.809	N	N	N	N
vg0406056639	T -> C	LOC_Os04g11120.1	downstream_gene_variant ; 3246.0bp to feature; MODIFIER	silent_mutation	Average:15.998; most accessible tissue: Callus, score: 30.809	N	N	N	N
vg0406056639	T -> C	LOC_Os04g11140.1	downstream_gene_variant ; 2879.0bp to feature; MODIFIER	silent_mutation	Average:15.998; most accessible tissue: Callus, score: 30.809	N	N	N	N
vg0406056639	T -> C	LOC_Os04g11130-LOC_Os04g11140	intergenic_region ; MODIFIER	silent_mutation	Average:15.998; most accessible tissue: Callus, score: 30.809	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0406056639	NA	4.25E-06	mr1100	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406056639	NA	9.02E-06	mr1227	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406056639	7.68E-06	4.58E-07	mr1613	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406056639	NA	7.50E-06	mr1619	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406056639	NA	4.40E-06	mr1913	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406056639	2.62E-08	3.46E-08	mr1071_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406056639	4.60E-08	1.11E-08	mr1080_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406056639	2.14E-07	5.43E-10	mr1100_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406056639	1.55E-08	2.57E-08	mr1203_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406056639	4.01E-07	6.52E-08	mr1402_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406056639	1.20E-08	1.50E-09	mr1613_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406056639	6.13E-08	2.75E-08	mr1619_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406056639	NA	1.57E-06	mr1795_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406056639	1.96E-06	NA	mr1888_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406056639	NA	1.04E-06	mr1896_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406056639	1.66E-09	2.90E-11	mr1913_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406056639	5.68E-08	1.30E-10	mr1962_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251