\
| Variant ID: vg0406050134 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 6050134 |
| Reference Allele: C | Alternative Allele: A,T |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.04, A: 0.01, others allele: 0.00, population size: 94. )
ATTTTCTCGGCCCAACAAAAACCGTAAATCCCTAACCCTAGAGCTGCTTGGCTGCTCTACCCAATCCCCCAGTCAACCTGTCCTAAGTCGCAACCAGCGT[C/A,T]
GTCGTACTCTTACGCGGTGGCACGGCGGCGCCAGCACAGTGACAGCTCTGGTCCGTTCCCCAGCGATGATTGCGCTAGCCGGCTAAGCTTCCTCACGACG
CGTCGTGAGGAAGCTTAGCCGGCTAGCGCAATCATCGCTGGGGAACGGACCAGAGCTGTCACTGTGCTGGCGCCGCCGTGCCACCGCGTAAGAGTACGAC[G/T,A]
ACGCTGGTTGCGACTTAGGACAGGTTGACTGGGGGATTGGGTAGAGCAGCCAAGCAGCTCTAGGGTTAGGGATTTACGGTTTTTGTTGGGCCGAGAAAAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 78.10% | 21.70% | 0.04% | 0.00% | T: 0.08% |
| All Indica | 2759 | 79.70% | 20.10% | 0.07% | 0.00% | T: 0.14% |
| All Japonica | 1512 | 81.00% | 19.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 55.80% | 44.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 79.00% | 20.80% | 0.17% | 0.00% | NA |
| Indica II | 465 | 86.70% | 13.30% | 0.00% | 0.00% | NA |
| Indica III | 913 | 81.40% | 18.20% | 0.00% | 0.00% | T: 0.44% |
| Indica Intermediate | 786 | 74.20% | 25.70% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 95.40% | 4.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 56.00% | 44.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 87.10% | 12.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 54.20% | 45.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 75.60% | 24.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0406050134 | C -> A | LOC_Os04g11120.1 | upstream_gene_variant ; 1574.0bp to feature; MODIFIER | silent_mutation | Average:65.304; most accessible tissue: Zhenshan97 young leaf, score: 82.31 | N | N | N | N |
| vg0406050134 | C -> A | LOC_Os04g11110.1 | downstream_gene_variant ; 2659.0bp to feature; MODIFIER | silent_mutation | Average:65.304; most accessible tissue: Zhenshan97 young leaf, score: 82.31 | N | N | N | N |
| vg0406050134 | C -> A | LOC_Os04g11130.1 | downstream_gene_variant ; 3801.0bp to feature; MODIFIER | silent_mutation | Average:65.304; most accessible tissue: Zhenshan97 young leaf, score: 82.31 | N | N | N | N |
| vg0406050134 | C -> A | LOC_Os04g11110-LOC_Os04g11120 | intergenic_region ; MODIFIER | silent_mutation | Average:65.304; most accessible tissue: Zhenshan97 young leaf, score: 82.31 | N | N | N | N |
| vg0406050134 | C -> T | LOC_Os04g11120.1 | upstream_gene_variant ; 1574.0bp to feature; MODIFIER | silent_mutation | Average:65.304; most accessible tissue: Zhenshan97 young leaf, score: 82.31 | N | N | N | N |
| vg0406050134 | C -> T | LOC_Os04g11110.1 | downstream_gene_variant ; 2659.0bp to feature; MODIFIER | silent_mutation | Average:65.304; most accessible tissue: Zhenshan97 young leaf, score: 82.31 | N | N | N | N |
| vg0406050134 | C -> T | LOC_Os04g11130.1 | downstream_gene_variant ; 3801.0bp to feature; MODIFIER | silent_mutation | Average:65.304; most accessible tissue: Zhenshan97 young leaf, score: 82.31 | N | N | N | N |
| vg0406050134 | C -> T | LOC_Os04g11110-LOC_Os04g11120 | intergenic_region ; MODIFIER | silent_mutation | Average:65.304; most accessible tissue: Zhenshan97 young leaf, score: 82.31 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0406050134 | NA | 4.51E-06 | mr1100 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406050134 | NA | 1.17E-06 | mr1227 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406050134 | NA | 7.70E-06 | mr1408 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406050134 | NA | 1.80E-06 | mr1613 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406050134 | NA | 3.17E-06 | mr1638 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406050134 | NA | 2.04E-06 | mr1695 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406050134 | 5.69E-06 | 2.52E-07 | mr1071_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406050134 | NA | 1.62E-07 | mr1080_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406050134 | NA | 7.52E-09 | mr1100_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406050134 | 1.88E-06 | 5.98E-08 | mr1203_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406050134 | NA | 7.73E-07 | mr1402_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406050134 | 2.24E-06 | 1.87E-08 | mr1613_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406050134 | 9.01E-06 | 5.97E-07 | mr1619_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406050134 | NA | 2.82E-06 | mr1795_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406050134 | NA | 3.24E-06 | mr1896_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406050134 | 3.37E-09 | 8.16E-11 | mr1913_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406050134 | 7.97E-07 | 7.10E-10 | mr1962_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |