\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406050134:

Variant ID: vg0406050134 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 6050134
Reference Allele: CAlternative Allele: A,T
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.04, A: 0.01, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


ATTTTCTCGGCCCAACAAAAACCGTAAATCCCTAACCCTAGAGCTGCTTGGCTGCTCTACCCAATCCCCCAGTCAACCTGTCCTAAGTCGCAACCAGCGT[C/A,T]
GTCGTACTCTTACGCGGTGGCACGGCGGCGCCAGCACAGTGACAGCTCTGGTCCGTTCCCCAGCGATGATTGCGCTAGCCGGCTAAGCTTCCTCACGACG

Reverse complement sequence

CGTCGTGAGGAAGCTTAGCCGGCTAGCGCAATCATCGCTGGGGAACGGACCAGAGCTGTCACTGTGCTGGCGCCGCCGTGCCACCGCGTAAGAGTACGAC[G/T,A]
ACGCTGGTTGCGACTTAGGACAGGTTGACTGGGGGATTGGGTAGAGCAGCCAAGCAGCTCTAGGGTTAGGGATTTACGGTTTTTGTTGGGCCGAGAAAAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.10% 21.70% 0.04% 0.00% T: 0.08%
All Indica  2759 79.70% 20.10% 0.07% 0.00% T: 0.14%
All Japonica  1512 81.00% 19.00% 0.00% 0.00% NA
Aus  269 55.80% 44.20% 0.00% 0.00% NA
Indica I  595 79.00% 20.80% 0.17% 0.00% NA
Indica II  465 86.70% 13.30% 0.00% 0.00% NA
Indica III  913 81.40% 18.20% 0.00% 0.00% T: 0.44%
Indica Intermediate  786 74.20% 25.70% 0.13% 0.00% NA
Temperate Japonica  767 95.40% 4.60% 0.00% 0.00% NA
Tropical Japonica  504 56.00% 44.00% 0.00% 0.00% NA
Japonica Intermediate  241 87.10% 12.90% 0.00% 0.00% NA
VI/Aromatic  96 54.20% 45.80% 0.00% 0.00% NA
Intermediate  90 75.60% 24.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0406050134 C -> A LOC_Os04g11120.1 upstream_gene_variant ; 1574.0bp to feature; MODIFIER silent_mutation Average:65.304; most accessible tissue: Zhenshan97 young leaf, score: 82.31 N N N N
vg0406050134 C -> A LOC_Os04g11110.1 downstream_gene_variant ; 2659.0bp to feature; MODIFIER silent_mutation Average:65.304; most accessible tissue: Zhenshan97 young leaf, score: 82.31 N N N N
vg0406050134 C -> A LOC_Os04g11130.1 downstream_gene_variant ; 3801.0bp to feature; MODIFIER silent_mutation Average:65.304; most accessible tissue: Zhenshan97 young leaf, score: 82.31 N N N N
vg0406050134 C -> A LOC_Os04g11110-LOC_Os04g11120 intergenic_region ; MODIFIER silent_mutation Average:65.304; most accessible tissue: Zhenshan97 young leaf, score: 82.31 N N N N
vg0406050134 C -> T LOC_Os04g11120.1 upstream_gene_variant ; 1574.0bp to feature; MODIFIER silent_mutation Average:65.304; most accessible tissue: Zhenshan97 young leaf, score: 82.31 N N N N
vg0406050134 C -> T LOC_Os04g11110.1 downstream_gene_variant ; 2659.0bp to feature; MODIFIER silent_mutation Average:65.304; most accessible tissue: Zhenshan97 young leaf, score: 82.31 N N N N
vg0406050134 C -> T LOC_Os04g11130.1 downstream_gene_variant ; 3801.0bp to feature; MODIFIER silent_mutation Average:65.304; most accessible tissue: Zhenshan97 young leaf, score: 82.31 N N N N
vg0406050134 C -> T LOC_Os04g11110-LOC_Os04g11120 intergenic_region ; MODIFIER silent_mutation Average:65.304; most accessible tissue: Zhenshan97 young leaf, score: 82.31 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0406050134 NA 4.51E-06 mr1100 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406050134 NA 1.17E-06 mr1227 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406050134 NA 7.70E-06 mr1408 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406050134 NA 1.80E-06 mr1613 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406050134 NA 3.17E-06 mr1638 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406050134 NA 2.04E-06 mr1695 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406050134 5.69E-06 2.52E-07 mr1071_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406050134 NA 1.62E-07 mr1080_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406050134 NA 7.52E-09 mr1100_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406050134 1.88E-06 5.98E-08 mr1203_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406050134 NA 7.73E-07 mr1402_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406050134 2.24E-06 1.87E-08 mr1613_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406050134 9.01E-06 5.97E-07 mr1619_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406050134 NA 2.82E-06 mr1795_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406050134 NA 3.24E-06 mr1896_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406050134 3.37E-09 8.16E-11 mr1913_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406050134 7.97E-07 7.10E-10 mr1962_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251