\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406024658:

Variant ID: vg0406024658 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 6024658
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.05, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:


CTACAGTATTAGGGATGTGCAATTTTTCATGCTATTGCATCAATTTTTATGTTAGCTCACTGCATATAATATCTTTACCCCCTTTATTTTGTATAAGTGC[A/G]
TGTTCAATGAATGAACATTTCCCTCATATATCACCACCATAGCATATATATATGGGCCTCCACATGAAGTTGGGGATACAAATGGACCGAATTCCATTAA

Reverse complement sequence

TTAATGGAATTCGGTCCATTTGTATCCCCAACTTCATGTGGAGGCCCATATATATATGCTATGGTGGTGATATATGAGGGAAATGTTCATTCATTGAACA[T/C]
GCACTTATACAAAATAAAGGGGGTAAAGATATTATATGCAGTGAGCTAACATAAAAATTGATGCAATAGCATGAAAAATTGCACATCCCTAATACTGTAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.40% 44.90% 0.70% 0.02% NA
All Indica  2759 58.00% 41.80% 0.18% 0.00% NA
All Japonica  1512 36.40% 61.60% 1.85% 0.07% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 27.40% 72.40% 0.17% 0.00% NA
Indica II  465 59.10% 40.90% 0.00% 0.00% NA
Indica III  913 71.00% 28.90% 0.11% 0.00% NA
Indica Intermediate  786 65.40% 34.20% 0.38% 0.00% NA
Temperate Japonica  767 29.90% 70.10% 0.00% 0.00% NA
Tropical Japonica  504 52.80% 42.70% 4.37% 0.20% NA
Japonica Intermediate  241 23.20% 74.30% 2.49% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 64.40% 35.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0406024658 A -> DEL N N silent_mutation Average:24.12; most accessible tissue: Zhenshan97 young leaf, score: 35.853 N N N N
vg0406024658 A -> G LOC_Os04g11080.1 upstream_gene_variant ; 3383.0bp to feature; MODIFIER silent_mutation Average:24.12; most accessible tissue: Zhenshan97 young leaf, score: 35.853 N N N N
vg0406024658 A -> G LOC_Os04g11070-LOC_Os04g11080 intergenic_region ; MODIFIER silent_mutation Average:24.12; most accessible tissue: Zhenshan97 young leaf, score: 35.853 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0406024658 2.17E-06 2.83E-14 mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406024658 NA 6.25E-07 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406024658 2.22E-06 1.51E-07 mr1312 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406024658 NA 7.27E-08 mr1403 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406024658 1.94E-06 1.85E-09 mr1525 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406024658 4.39E-06 4.39E-06 mr1525 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406024658 NA 6.76E-06 mr1569 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406024658 NA 6.98E-06 mr1626 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406024658 NA 7.39E-07 mr1649 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406024658 NA 4.65E-06 mr1830 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406024658 NA 3.68E-11 mr1846 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406024658 NA 5.67E-09 mr1846 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406024658 NA 3.45E-07 mr1035_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406024658 NA 9.33E-07 mr1158_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406024658 NA 3.00E-07 mr1167_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406024658 NA 5.28E-09 mr1608_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406024658 NA 6.80E-07 mr1631_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406024658 NA 1.54E-06 mr1818_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406024658 NA 9.99E-06 mr1835_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406024658 NA 5.23E-15 mr1846_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406024658 NA 1.55E-12 mr1846_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406024658 NA 8.99E-06 mr1892_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406024658 NA 3.95E-06 mr1913_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251