\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405980260:

Variant ID: vg0405980260 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 5980260
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTGCTTTTAGGTTTGGCCACGTGGCACAATGAGCTGATAGAATTTGCACCCTGAATTCGGTCTTTTAGATAGATAGATTGTTTAGGTAACTGAACTCTTG[A/G]
ACAGGACTTGTCTGGGATGTTATACATGTTCAAACGAACTTCAACCCACTTTTCTTTTTGAAAAGAAACTCCAACCCACTTCGTAGTACATGCTATGGTA

Reverse complement sequence

TACCATAGCATGTACTACGAAGTGGGTTGGAGTTTCTTTTCAAAAAGAAAAGTGGGTTGAAGTTCGTTTGAACATGTATAACATCCCAGACAAGTCCTGT[T/C]
CAAGAGTTCAGTTACCTAAACAATCTATCTATCTAAAAGACCGAATTCAGGGTGCAAATTCTATCAGCTCATTGTGCCACGTGGCCAAACCTAAAAGCAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.00% 0.70% 0.53% 26.75% NA
All Indica  2759 79.30% 0.10% 0.72% 19.83% NA
All Japonica  1512 64.70% 1.60% 0.20% 33.47% NA
Aus  269 45.00% 0.70% 0.74% 53.53% NA
Indica I  595 82.00% 0.20% 0.00% 17.82% NA
Indica II  465 82.20% 0.20% 3.44% 14.19% NA
Indica III  913 79.40% 0.00% 0.00% 20.59% NA
Indica Intermediate  786 75.40% 0.30% 0.51% 23.79% NA
Temperate Japonica  767 69.50% 2.00% 0.26% 28.29% NA
Tropical Japonica  504 49.20% 1.80% 0.20% 48.81% NA
Japonica Intermediate  241 82.20% 0.00% 0.00% 17.84% NA
VI/Aromatic  96 51.00% 0.00% 0.00% 48.96% NA
Intermediate  90 75.60% 2.20% 0.00% 22.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0405980260 A -> DEL N N silent_mutation Average:73.259; most accessible tissue: Minghui63 root, score: 88.513 N N N N
vg0405980260 A -> G LOC_Os04g10990.1 upstream_gene_variant ; 4466.0bp to feature; MODIFIER silent_mutation Average:73.259; most accessible tissue: Minghui63 root, score: 88.513 N N N N
vg0405980260 A -> G LOC_Os04g11004.1 upstream_gene_variant ; 863.0bp to feature; MODIFIER silent_mutation Average:73.259; most accessible tissue: Minghui63 root, score: 88.513 N N N N
vg0405980260 A -> G LOC_Os04g11004-LOC_Os04g11030 intergenic_region ; MODIFIER silent_mutation Average:73.259; most accessible tissue: Minghui63 root, score: 88.513 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0405980260 NA 2.32E-06 mr1262 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405980260 7.63E-06 7.63E-06 mr1525 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405980260 NA 2.06E-06 mr1035_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405980260 4.89E-06 NA mr1399_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405980260 NA 5.86E-06 mr1631_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251