| Variant ID: vg0405980260 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 5980260 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TTGCTTTTAGGTTTGGCCACGTGGCACAATGAGCTGATAGAATTTGCACCCTGAATTCGGTCTTTTAGATAGATAGATTGTTTAGGTAACTGAACTCTTG[A/G]
ACAGGACTTGTCTGGGATGTTATACATGTTCAAACGAACTTCAACCCACTTTTCTTTTTGAAAAGAAACTCCAACCCACTTCGTAGTACATGCTATGGTA
TACCATAGCATGTACTACGAAGTGGGTTGGAGTTTCTTTTCAAAAAGAAAAGTGGGTTGAAGTTCGTTTGAACATGTATAACATCCCAGACAAGTCCTGT[T/C]
CAAGAGTTCAGTTACCTAAACAATCTATCTATCTAAAAGACCGAATTCAGGGTGCAAATTCTATCAGCTCATTGTGCCACGTGGCCAAACCTAAAAGCAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 72.00% | 0.70% | 0.53% | 26.75% | NA |
| All Indica | 2759 | 79.30% | 0.10% | 0.72% | 19.83% | NA |
| All Japonica | 1512 | 64.70% | 1.60% | 0.20% | 33.47% | NA |
| Aus | 269 | 45.00% | 0.70% | 0.74% | 53.53% | NA |
| Indica I | 595 | 82.00% | 0.20% | 0.00% | 17.82% | NA |
| Indica II | 465 | 82.20% | 0.20% | 3.44% | 14.19% | NA |
| Indica III | 913 | 79.40% | 0.00% | 0.00% | 20.59% | NA |
| Indica Intermediate | 786 | 75.40% | 0.30% | 0.51% | 23.79% | NA |
| Temperate Japonica | 767 | 69.50% | 2.00% | 0.26% | 28.29% | NA |
| Tropical Japonica | 504 | 49.20% | 1.80% | 0.20% | 48.81% | NA |
| Japonica Intermediate | 241 | 82.20% | 0.00% | 0.00% | 17.84% | NA |
| VI/Aromatic | 96 | 51.00% | 0.00% | 0.00% | 48.96% | NA |
| Intermediate | 90 | 75.60% | 2.20% | 0.00% | 22.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0405980260 | A -> DEL | N | N | silent_mutation | Average:73.259; most accessible tissue: Minghui63 root, score: 88.513 | N | N | N | N |
| vg0405980260 | A -> G | LOC_Os04g10990.1 | upstream_gene_variant ; 4466.0bp to feature; MODIFIER | silent_mutation | Average:73.259; most accessible tissue: Minghui63 root, score: 88.513 | N | N | N | N |
| vg0405980260 | A -> G | LOC_Os04g11004.1 | upstream_gene_variant ; 863.0bp to feature; MODIFIER | silent_mutation | Average:73.259; most accessible tissue: Minghui63 root, score: 88.513 | N | N | N | N |
| vg0405980260 | A -> G | LOC_Os04g11004-LOC_Os04g11030 | intergenic_region ; MODIFIER | silent_mutation | Average:73.259; most accessible tissue: Minghui63 root, score: 88.513 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0405980260 | NA | 2.32E-06 | mr1262 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405980260 | 7.63E-06 | 7.63E-06 | mr1525 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405980260 | NA | 2.06E-06 | mr1035_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405980260 | 4.89E-06 | NA | mr1399_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405980260 | NA | 5.86E-06 | mr1631_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |