\
| Variant ID: vg0405898738 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 5898738 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.94, C: 0.07, others allele: 0.00, population size: 90. )
TTTAAACACAGTGTTCTTAGGCTCAGATTCAATCAAAATTTCACCTCTCCTAGCAACACCCAAAACAGTAGGAGGATGTCTAGAATTAAGAACATAAGGA[C/T]
CAAAACCTAAACCACGATTGTGTGTGCTAATCTTAGATTGATCAAGAATCATGTTGAGGTTCTTTTTACCATCAGAAAATCTTTGCAAAAAACTTTTCAA
TTGAAAAGTTTTTTGCAAAGATTTTCTGATGGTAAAAAGAACCTCAACATGATTCTTGATCAATCTAAGATTAGCACACACAATCGTGGTTTAGGTTTTG[G/A]
TCCTTATGTTCTTAATTCTAGACATCCTCCTACTGTTTTGGGTGTTGCTAGGAGAGGTGAAATTTTGATTGAATCTGAGCCTAAGAACACTGTGTTTAAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 70.10% | 19.70% | 2.52% | 7.66% | NA |
| All Indica | 2759 | 96.80% | 1.20% | 1.23% | 0.83% | NA |
| All Japonica | 1512 | 16.80% | 57.70% | 3.64% | 21.89% | NA |
| Aus | 269 | 88.50% | 2.20% | 8.55% | 0.74% | NA |
| Indica I | 595 | 95.50% | 1.00% | 2.02% | 1.51% | NA |
| Indica II | 465 | 96.80% | 2.40% | 0.22% | 0.65% | NA |
| Indica III | 913 | 99.50% | 0.20% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 94.70% | 1.70% | 2.29% | 1.40% | NA |
| Temperate Japonica | 767 | 3.80% | 65.20% | 3.00% | 28.03% | NA |
| Tropical Japonica | 504 | 39.50% | 38.90% | 5.16% | 16.47% | NA |
| Japonica Intermediate | 241 | 10.80% | 73.00% | 2.49% | 13.69% | NA |
| VI/Aromatic | 96 | 92.70% | 1.00% | 5.21% | 1.04% | NA |
| Intermediate | 90 | 71.10% | 21.10% | 2.22% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0405898738 | C -> DEL | N | N | silent_mutation | Average:12.358; most accessible tissue: Callus, score: 23.415 | N | N | N | N |
| vg0405898738 | C -> T | LOC_Os04g10870.1 | upstream_gene_variant ; 2630.0bp to feature; MODIFIER | silent_mutation | Average:12.358; most accessible tissue: Callus, score: 23.415 | N | N | N | N |
| vg0405898738 | C -> T | LOC_Os04g10880.1 | downstream_gene_variant ; 312.0bp to feature; MODIFIER | silent_mutation | Average:12.358; most accessible tissue: Callus, score: 23.415 | N | N | N | N |
| vg0405898738 | C -> T | LOC_Os04g10870-LOC_Os04g10880 | intergenic_region ; MODIFIER | silent_mutation | Average:12.358; most accessible tissue: Callus, score: 23.415 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0405898738 | NA | 1.48E-16 | mr1062 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405898738 | NA | 4.82E-07 | mr1073 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405898738 | NA | 6.33E-07 | mr1227 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405898738 | 3.56E-06 | 9.44E-13 | mr1239 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405898738 | NA | 3.62E-09 | mr1368 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405898738 | 6.74E-06 | 6.74E-06 | mr1525 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405898738 | 1.95E-06 | NA | mr1560 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405898738 | NA | 7.97E-09 | mr1866 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405898738 | 2.80E-06 | 1.54E-17 | mr1035_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405898738 | NA | 1.73E-07 | mr1035_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405898738 | 9.66E-06 | NA | mr1100_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405898738 | NA | 2.41E-07 | mr1100_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405898738 | NA | 1.09E-31 | mr1631_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405898738 | NA | 5.47E-07 | mr1631_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |