\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405898738:

Variant ID: vg0405898738 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 5898738
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.94, C: 0.07, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


TTTAAACACAGTGTTCTTAGGCTCAGATTCAATCAAAATTTCACCTCTCCTAGCAACACCCAAAACAGTAGGAGGATGTCTAGAATTAAGAACATAAGGA[C/T]
CAAAACCTAAACCACGATTGTGTGTGCTAATCTTAGATTGATCAAGAATCATGTTGAGGTTCTTTTTACCATCAGAAAATCTTTGCAAAAAACTTTTCAA

Reverse complement sequence

TTGAAAAGTTTTTTGCAAAGATTTTCTGATGGTAAAAAGAACCTCAACATGATTCTTGATCAATCTAAGATTAGCACACACAATCGTGGTTTAGGTTTTG[G/A]
TCCTTATGTTCTTAATTCTAGACATCCTCCTACTGTTTTGGGTGTTGCTAGGAGAGGTGAAATTTTGATTGAATCTGAGCCTAAGAACACTGTGTTTAAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.10% 19.70% 2.52% 7.66% NA
All Indica  2759 96.80% 1.20% 1.23% 0.83% NA
All Japonica  1512 16.80% 57.70% 3.64% 21.89% NA
Aus  269 88.50% 2.20% 8.55% 0.74% NA
Indica I  595 95.50% 1.00% 2.02% 1.51% NA
Indica II  465 96.80% 2.40% 0.22% 0.65% NA
Indica III  913 99.50% 0.20% 0.33% 0.00% NA
Indica Intermediate  786 94.70% 1.70% 2.29% 1.40% NA
Temperate Japonica  767 3.80% 65.20% 3.00% 28.03% NA
Tropical Japonica  504 39.50% 38.90% 5.16% 16.47% NA
Japonica Intermediate  241 10.80% 73.00% 2.49% 13.69% NA
VI/Aromatic  96 92.70% 1.00% 5.21% 1.04% NA
Intermediate  90 71.10% 21.10% 2.22% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0405898738 C -> DEL N N silent_mutation Average:12.358; most accessible tissue: Callus, score: 23.415 N N N N
vg0405898738 C -> T LOC_Os04g10870.1 upstream_gene_variant ; 2630.0bp to feature; MODIFIER silent_mutation Average:12.358; most accessible tissue: Callus, score: 23.415 N N N N
vg0405898738 C -> T LOC_Os04g10880.1 downstream_gene_variant ; 312.0bp to feature; MODIFIER silent_mutation Average:12.358; most accessible tissue: Callus, score: 23.415 N N N N
vg0405898738 C -> T LOC_Os04g10870-LOC_Os04g10880 intergenic_region ; MODIFIER silent_mutation Average:12.358; most accessible tissue: Callus, score: 23.415 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0405898738 NA 1.48E-16 mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405898738 NA 4.82E-07 mr1073 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405898738 NA 6.33E-07 mr1227 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405898738 3.56E-06 9.44E-13 mr1239 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405898738 NA 3.62E-09 mr1368 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405898738 6.74E-06 6.74E-06 mr1525 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405898738 1.95E-06 NA mr1560 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405898738 NA 7.97E-09 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405898738 2.80E-06 1.54E-17 mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405898738 NA 1.73E-07 mr1035_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405898738 9.66E-06 NA mr1100_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405898738 NA 2.41E-07 mr1100_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405898738 NA 1.09E-31 mr1631_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405898738 NA 5.47E-07 mr1631_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251