\
| Variant ID: vg0405891709 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 5891709 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, C: 0.01, others allele: 0.00, population size: 77. )
GCAATGGCGAATGCTATCAGTAAGGTAATGCCGGGTGCTTACCATAGATTGTGTATTTGGCATATAGAGGAGAATATGAGTCGTCACCTTCGTAAGCCAA[C/A]
ACTTGATGAGCTAAGAAAATTAATTTATGCGAGTATGGATGAGGAGGAGTTCGAGAGACGCTTGGGCTGATTTTAAGGAGAATGGAGGCATGGGAAATGG
CCATTTCCCATGCCTCCATTCTCCTTAAAATCAGCCCAAGCGTCTCTCGAACTCCTCCTCATCCATACTCGCATAAATTAATTTTCTTAGCTCATCAAGT[G/T]
TTGGCTTACGAAGGTGACGACTCATATTCTCCTCTATATGCCAAATACACAATCTATGGTAAGCACCCGGCATTACCTTACTGATAGCATTCGCCATTGC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 21.30% | 5.70% | 0.99% | 72.01% | NA |
| All Indica | 2759 | 2.40% | 6.50% | 1.16% | 89.96% | NA |
| All Japonica | 1512 | 60.00% | 4.40% | 0.46% | 35.12% | NA |
| Aus | 269 | 3.30% | 6.30% | 1.86% | 88.48% | NA |
| Indica I | 595 | 2.70% | 0.50% | 1.34% | 95.46% | NA |
| Indica II | 465 | 3.90% | 10.10% | 1.08% | 84.95% | NA |
| Indica III | 913 | 0.90% | 10.00% | 1.31% | 87.84% | NA |
| Indica Intermediate | 786 | 3.20% | 4.70% | 0.89% | 91.22% | NA |
| Temperate Japonica | 767 | 66.60% | 3.30% | 0.65% | 29.47% | NA |
| Tropical Japonica | 504 | 43.50% | 5.20% | 0.40% | 50.99% | NA |
| Japonica Intermediate | 241 | 73.40% | 6.60% | 0.00% | 19.92% | NA |
| VI/Aromatic | 96 | 2.10% | 4.20% | 0.00% | 93.75% | NA |
| Intermediate | 90 | 23.30% | 4.40% | 3.33% | 68.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0405891709 | C -> DEL | N | N | silent_mutation | Average:11.588; most accessible tissue: Callus, score: 53.106 | N | N | N | N |
| vg0405891709 | C -> A | LOC_Os04g10850.1 | upstream_gene_variant ; 1951.0bp to feature; MODIFIER | silent_mutation | Average:11.588; most accessible tissue: Callus, score: 53.106 | N | N | N | N |
| vg0405891709 | C -> A | LOC_Os04g10870.1 | downstream_gene_variant ; 2712.0bp to feature; MODIFIER | silent_mutation | Average:11.588; most accessible tissue: Callus, score: 53.106 | N | N | N | N |
| vg0405891709 | C -> A | LOC_Os04g10860.1 | intron_variant ; MODIFIER | silent_mutation | Average:11.588; most accessible tissue: Callus, score: 53.106 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0405891709 | NA | 5.82E-15 | mr1059 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405891709 | NA | 1.36E-15 | mr1143 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405891709 | NA | 3.36E-16 | mr1167 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405891709 | 5.90E-07 | 1.07E-09 | mr1227 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405891709 | NA | 4.29E-06 | mr1227 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405891709 | NA | 2.45E-15 | mr1535 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405891709 | NA | 2.09E-15 | mr1675 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405891709 | NA | 2.06E-08 | mr1677 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405891709 | NA | 1.23E-07 | mr1680 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405891709 | NA | 4.00E-22 | mr1698 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405891709 | NA | 7.68E-15 | mr1726 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405891709 | NA | 4.04E-10 | mr1866 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405891709 | NA | 6.96E-14 | mr1940 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405891709 | NA | 1.25E-15 | mr1969 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405891709 | NA | 1.45E-18 | mr1995 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405891709 | NA | 2.26E-14 | mr1035_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405891709 | NA | 6.68E-06 | mr1080_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405891709 | 3.05E-06 | NA | mr1100_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405891709 | NA | 9.21E-08 | mr1100_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405891709 | 8.11E-06 | NA | mr1203_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405891709 | NA | 4.21E-06 | mr1203_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405891709 | NA | 7.41E-06 | mr1613_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405891709 | NA | 3.68E-07 | mr1748_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405891709 | 1.87E-06 | 2.22E-06 | mr1913_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405891709 | NA | 9.20E-06 | mr1962_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |