\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405876106:

Variant ID: vg0405876106 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 5876106
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAAAGCTCGCTGGATCCGGCCACCCTGAGCTTGCCCTCACTAGATGTGGTCTCTGGAGAGCGGTCGCACTCGGGTGGCGTGTCACTGCCATTGCCTCCAC[G/A]
GGAGGTTGGCCCTCCTTTCCTTTTCCCTTCCTACTTCTGTAGTTCATTTGTTGGTCGCCATTGTCGACACCGCATCTCACCTCTTCCCCGACGACGCGAC

Reverse complement sequence

GTCGCGTCGTCGGGGAAGAGGTGAGATGCGGTGTCGACAATGGCGACCAACAAATGAACTACAGAAGTAGGAAGGGAAAAGGAAAGGAGGGCCAACCTCC[C/T]
GTGGAGGCAATGGCAGTGACACGCCACCCGAGTGCGACCGCTCTCCAGAGACCACATCTAGTGAGGGCAAGCTCAGGGTGGCCGGATCCAGCGAGCTTTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.00% 47.90% 0.13% 0.00% NA
All Indica  2759 25.20% 74.60% 0.22% 0.00% NA
All Japonica  1512 97.80% 2.20% 0.00% 0.00% NA
Aus  269 68.40% 31.60% 0.00% 0.00% NA
Indica I  595 21.20% 78.30% 0.50% 0.00% NA
Indica II  465 23.40% 76.30% 0.22% 0.00% NA
Indica III  913 25.20% 74.70% 0.11% 0.00% NA
Indica Intermediate  786 29.40% 70.50% 0.13% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 94.80% 5.20% 0.00% 0.00% NA
Japonica Intermediate  241 97.90% 2.10% 0.00% 0.00% NA
VI/Aromatic  96 50.00% 50.00% 0.00% 0.00% NA
Intermediate  90 56.70% 43.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0405876106 G -> A LOC_Os04g10820.1 upstream_gene_variant ; 3287.0bp to feature; MODIFIER silent_mutation Average:59.72; most accessible tissue: Zhenshan97 flag leaf, score: 81.605 N N N N
vg0405876106 G -> A LOC_Os04g10840.1 upstream_gene_variant ; 4303.0bp to feature; MODIFIER silent_mutation Average:59.72; most accessible tissue: Zhenshan97 flag leaf, score: 81.605 N N N N
vg0405876106 G -> A LOC_Os04g10820-LOC_Os04g10840 intergenic_region ; MODIFIER silent_mutation Average:59.72; most accessible tissue: Zhenshan97 flag leaf, score: 81.605 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0405876106 NA 1.52E-15 mr1035 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405876106 NA 2.53E-07 mr1035 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405876106 2.09E-09 1.31E-21 mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405876106 NA 1.32E-06 mr1062 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405876106 NA 8.49E-08 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405876106 NA 5.22E-06 mr1143 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405876106 7.86E-06 1.29E-15 mr1167 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405876106 1.51E-08 8.91E-07 mr1525 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405876106 6.00E-06 6.00E-06 mr1525 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405876106 NA 2.40E-13 mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405876106 NA 8.35E-08 mr1626 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405876106 7.67E-06 4.76E-15 mr1675 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405876106 NA 6.13E-07 mr1677 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405876106 1.97E-07 NA mr1698 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405876106 NA 6.09E-06 mr1698 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405876106 NA 6.04E-14 mr1726 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405876106 7.80E-06 7.79E-15 mr1969 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405876106 NA 8.21E-06 mr1969 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405876106 3.19E-06 3.19E-16 mr1995 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405876106 NA 4.94E-07 mr1995 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405876106 4.04E-10 8.23E-21 mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405876106 NA 2.36E-08 mr1035_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405876106 NA 1.53E-19 mr1062_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405876106 NA 2.04E-07 mr1100_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405876106 1.39E-07 4.92E-29 mr1631_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405876106 NA 7.77E-08 mr1631_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405876106 NA 9.80E-08 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405876106 NA 7.26E-06 mr1913_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251