\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405832157:

Variant ID: vg0405832157 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 5832157
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCATAGCCCCCAAGCACCAGGAGTCGGCCTAGGCACTTCCCAAACATGCATACGAGTGATATGAGTTCGTCATTAATGGAACAAAGTTTCACGGGTCAGA[G/A]
TTTACTACTTGGGTACTTTTGCAATTATTAAGAGCAGAAAACAAATTTATTTTATCTCTATGCTTTTGATTTATTCTGAATAATACTTAGCACCTTGCAT

Reverse complement sequence

ATGCAAGGTGCTAAGTATTATTCAGAATAAATCAAAAGCATAGAGATAAAATAAATTTGTTTTCTGCTCTTAATAATTGCAAAAGTACCCAAGTAGTAAA[C/T]
TCTGACCCGTGAAACTTTGTTCCATTAATGACGAACTCATATCACTCGTATGCATGTTTGGGAAGTGCCTAGGCCGACTCCTGGTGCTTGGGGGCTATGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 33.60% 2.80% 9.25% 54.32% NA
All Indica  2759 7.70% 4.30% 9.28% 78.72% NA
All Japonica  1512 80.40% 0.00% 0.93% 18.72% NA
Aus  269 9.70% 4.80% 58.74% 26.77% NA
Indica I  595 3.00% 0.20% 4.54% 92.27% NA
Indica II  465 10.50% 0.60% 8.17% 80.65% NA
Indica III  913 9.10% 10.60% 14.35% 65.94% NA
Indica Intermediate  786 7.90% 2.30% 7.63% 82.19% NA
Temperate Japonica  767 94.30% 0.00% 0.13% 5.61% NA
Tropical Japonica  504 56.50% 0.00% 2.38% 41.07% NA
Japonica Intermediate  241 85.90% 0.00% 0.41% 13.69% NA
VI/Aromatic  96 95.80% 1.00% 2.08% 1.04% NA
Intermediate  90 47.80% 1.10% 7.78% 43.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0405832157 G -> DEL N N silent_mutation Average:9.777; most accessible tissue: Zhenshan97 panicle, score: 16.188 N N N N
vg0405832157 G -> A LOC_Os04g10720.1 upstream_gene_variant ; 4502.0bp to feature; MODIFIER silent_mutation Average:9.777; most accessible tissue: Zhenshan97 panicle, score: 16.188 N N N N
vg0405832157 G -> A LOC_Os04g10724.1 downstream_gene_variant ; 2444.0bp to feature; MODIFIER silent_mutation Average:9.777; most accessible tissue: Zhenshan97 panicle, score: 16.188 N N N N
vg0405832157 G -> A LOC_Os04g10740.1 downstream_gene_variant ; 3001.0bp to feature; MODIFIER silent_mutation Average:9.777; most accessible tissue: Zhenshan97 panicle, score: 16.188 N N N N
vg0405832157 G -> A LOC_Os04g10730.1 intron_variant ; MODIFIER silent_mutation Average:9.777; most accessible tissue: Zhenshan97 panicle, score: 16.188 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0405832157 NA 5.74E-07 mr1054 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405832157 NA 1.86E-07 mr1073 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405832157 NA 2.34E-06 mr1207 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405832157 NA 2.32E-07 mr1209 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405832157 NA 8.23E-07 mr1278 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405832157 NA 1.14E-07 mr1286 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405832157 NA 1.75E-06 mr1287 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405832157 NA 4.48E-06 mr1293 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405832157 NA 6.76E-06 mr1294 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405832157 NA 7.84E-08 mr1297 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405832157 3.92E-06 6.42E-08 mr1312 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405832157 NA 1.66E-06 mr1337 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405832157 NA 2.58E-06 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405832157 NA 1.75E-06 mr1372 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405832157 6.81E-06 6.81E-06 mr1381 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405832157 NA 7.37E-07 mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405832157 NA 3.65E-07 mr1433 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405832157 NA 2.54E-07 mr1434 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405832157 4.53E-06 4.52E-06 mr1497 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405832157 NA 9.67E-07 mr1512 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405832157 NA 1.05E-06 mr1616 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405832157 NA 6.13E-06 mr1633 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405832157 NA 5.31E-12 mr1649 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405832157 NA 4.56E-07 mr1665 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405832157 NA 3.77E-07 mr1687 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405832157 NA 6.46E-06 mr1774 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405832157 1.53E-06 8.90E-10 mr1777 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405832157 NA 2.55E-08 mr1787 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405832157 NA 7.46E-06 mr1901 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405832157 NA 1.54E-10 mr1939 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405832157 1.88E-06 9.62E-10 mr1963 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251