\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405740436:

Variant ID: vg0405740436 (JBrowse)Variation Type: INDEL
Chromosome: chr04Position: 5740436
Reference Allele: CAlternative Allele: G,CGCGCCTGG,CGCCTGGA
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.62, C: 0.38, others allele: 0.00, population size: 61. )

Flanking Sequence (100 bp) in Reference Genome:


AATGGTGCAGAGGAGAAAAAAGAGAAGCGGTAGAGACGGAGAGGAGATCGAGTGGAGAGTTTGATGGAGAAATGAGTTGGTGGTGGTGAAGAGTTGATGT[C/G,CGCGCCTGG,CGCCTGGA]
ACCATGGCTACTACGGATACATCCGTTGCTCACATCATGGATGAACAACAAGATATCAAGTTCGAGTCCTCCAAGTGCCAAAATCCAATTCGGCCACCTG

Reverse complement sequence

CAGGTGGCCGAATTGGATTTTGGCACTTGGAGGACTCGAACTTGATATCTTGTTGTTCATCCATGATGTGAGCAACGGATGTATCCGTAGTAGCCATGGT[G/C,CCAGGCGCG,TCCAGGCG]
ACATCAACTCTTCACCACCACCAACTCATTTCTCCATCAAACTCTCCACTCGATCTCCTCTCCGTCTCTACCGCTTCTCTTTTTTCTCCTCTGCACCATT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.00% 20.90% 2.69% 20.42% CGCGCCTGG: 0.02%; CGCCTGGA: 0.02%
All Indica  2759 81.70% 6.80% 2.39% 9.13% NA
All Japonica  1512 13.40% 51.20% 1.98% 33.33% CGCCTGGA: 0.07%
Aus  269 34.20% 0.70% 8.18% 56.88% NA
Indica I  595 84.50% 5.20% 0.50% 9.75% NA
Indica II  465 80.90% 9.90% 4.09% 5.16% NA
Indica III  913 81.30% 3.70% 3.83% 11.17% NA
Indica Intermediate  786 80.40% 9.80% 1.15% 8.65% NA
Temperate Japonica  767 2.60% 64.70% 0.78% 31.94% NA
Tropical Japonica  504 27.40% 25.20% 4.37% 42.86% CGCCTGGA: 0.20%
Japonica Intermediate  241 18.70% 62.70% 0.83% 17.84% NA
VI/Aromatic  96 49.00% 3.10% 4.17% 43.75% NA
Intermediate  90 56.70% 21.10% 5.56% 15.56% CGCGCCTGG: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0405740436 C -> DEL N N silent_mutation Average:54.409; most accessible tissue: Minghui63 root, score: 84.918 N N N N
vg0405740436 C -> CGCGCCTGG LOC_Os04g10590.1 upstream_gene_variant ; 2207.0bp to feature; MODIFIER silent_mutation Average:54.409; most accessible tissue: Minghui63 root, score: 84.918 N N N N
vg0405740436 C -> CGCGCCTGG LOC_Os04g10550.1 downstream_gene_variant ; 3374.0bp to feature; MODIFIER silent_mutation Average:54.409; most accessible tissue: Minghui63 root, score: 84.918 N N N N
vg0405740436 C -> CGCGCCTGG LOC_Os04g10569.1 intron_variant ; MODIFIER silent_mutation Average:54.409; most accessible tissue: Minghui63 root, score: 84.918 N N N N
vg0405740436 C -> G LOC_Os04g10590.1 upstream_gene_variant ; 2208.0bp to feature; MODIFIER silent_mutation Average:54.409; most accessible tissue: Minghui63 root, score: 84.918 N N N N
vg0405740436 C -> G LOC_Os04g10550.1 downstream_gene_variant ; 3373.0bp to feature; MODIFIER silent_mutation Average:54.409; most accessible tissue: Minghui63 root, score: 84.918 N N N N
vg0405740436 C -> G LOC_Os04g10569.1 intron_variant ; MODIFIER silent_mutation Average:54.409; most accessible tissue: Minghui63 root, score: 84.918 N N N N
vg0405740436 C -> CGCCTGGA LOC_Os04g10590.1 upstream_gene_variant ; 2207.0bp to feature; MODIFIER silent_mutation Average:54.409; most accessible tissue: Minghui63 root, score: 84.918 N N N N
vg0405740436 C -> CGCCTGGA LOC_Os04g10550.1 downstream_gene_variant ; 3374.0bp to feature; MODIFIER silent_mutation Average:54.409; most accessible tissue: Minghui63 root, score: 84.918 N N N N
vg0405740436 C -> CGCCTGGA LOC_Os04g10569.1 intron_variant ; MODIFIER silent_mutation Average:54.409; most accessible tissue: Minghui63 root, score: 84.918 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0405740436 NA 5.81E-06 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405740436 9.82E-11 3.47E-20 mr1035 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405740436 5.36E-07 1.09E-06 mr1035 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405740436 6.18E-10 5.22E-14 mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405740436 2.67E-06 NA mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405740436 9.36E-10 NA mr1525 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405740436 4.78E-10 3.61E-19 mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405740436 2.48E-07 5.13E-08 mr1626 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405740436 1.73E-08 1.80E-25 mr1631 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405740436 2.27E-06 2.27E-06 mr1631 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405740436 9.89E-10 6.99E-18 mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405740436 3.15E-15 1.43E-21 mr1062_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405740436 1.81E-08 3.43E-07 mr1062_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405740436 4.61E-09 NA mr1631_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405740436 NA 6.46E-06 mr1631_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405740436 NA 9.28E-10 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251