| Variant ID: vg0405740436 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr04 | Position: 5740436 |
| Reference Allele: C | Alternative Allele: G,CGCGCCTGG,CGCCTGGA |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.62, C: 0.38, others allele: 0.00, population size: 61. )
AATGGTGCAGAGGAGAAAAAAGAGAAGCGGTAGAGACGGAGAGGAGATCGAGTGGAGAGTTTGATGGAGAAATGAGTTGGTGGTGGTGAAGAGTTGATGT[C/G,CGCGCCTGG,CGCCTGGA]
ACCATGGCTACTACGGATACATCCGTTGCTCACATCATGGATGAACAACAAGATATCAAGTTCGAGTCCTCCAAGTGCCAAAATCCAATTCGGCCACCTG
CAGGTGGCCGAATTGGATTTTGGCACTTGGAGGACTCGAACTTGATATCTTGTTGTTCATCCATGATGTGAGCAACGGATGTATCCGTAGTAGCCATGGT[G/C,CCAGGCGCG,TCCAGGCG]
ACATCAACTCTTCACCACCACCAACTCATTTCTCCATCAAACTCTCCACTCGATCTCCTCTCCGTCTCTACCGCTTCTCTTTTTTCTCCTCTGCACCATT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.00% | 20.90% | 2.69% | 20.42% | CGCGCCTGG: 0.02%; CGCCTGGA: 0.02% |
| All Indica | 2759 | 81.70% | 6.80% | 2.39% | 9.13% | NA |
| All Japonica | 1512 | 13.40% | 51.20% | 1.98% | 33.33% | CGCCTGGA: 0.07% |
| Aus | 269 | 34.20% | 0.70% | 8.18% | 56.88% | NA |
| Indica I | 595 | 84.50% | 5.20% | 0.50% | 9.75% | NA |
| Indica II | 465 | 80.90% | 9.90% | 4.09% | 5.16% | NA |
| Indica III | 913 | 81.30% | 3.70% | 3.83% | 11.17% | NA |
| Indica Intermediate | 786 | 80.40% | 9.80% | 1.15% | 8.65% | NA |
| Temperate Japonica | 767 | 2.60% | 64.70% | 0.78% | 31.94% | NA |
| Tropical Japonica | 504 | 27.40% | 25.20% | 4.37% | 42.86% | CGCCTGGA: 0.20% |
| Japonica Intermediate | 241 | 18.70% | 62.70% | 0.83% | 17.84% | NA |
| VI/Aromatic | 96 | 49.00% | 3.10% | 4.17% | 43.75% | NA |
| Intermediate | 90 | 56.70% | 21.10% | 5.56% | 15.56% | CGCGCCTGG: 1.11% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0405740436 | C -> DEL | N | N | silent_mutation | Average:54.409; most accessible tissue: Minghui63 root, score: 84.918 | N | N | N | N |
| vg0405740436 | C -> CGCGCCTGG | LOC_Os04g10590.1 | upstream_gene_variant ; 2207.0bp to feature; MODIFIER | silent_mutation | Average:54.409; most accessible tissue: Minghui63 root, score: 84.918 | N | N | N | N |
| vg0405740436 | C -> CGCGCCTGG | LOC_Os04g10550.1 | downstream_gene_variant ; 3374.0bp to feature; MODIFIER | silent_mutation | Average:54.409; most accessible tissue: Minghui63 root, score: 84.918 | N | N | N | N |
| vg0405740436 | C -> CGCGCCTGG | LOC_Os04g10569.1 | intron_variant ; MODIFIER | silent_mutation | Average:54.409; most accessible tissue: Minghui63 root, score: 84.918 | N | N | N | N |
| vg0405740436 | C -> G | LOC_Os04g10590.1 | upstream_gene_variant ; 2208.0bp to feature; MODIFIER | silent_mutation | Average:54.409; most accessible tissue: Minghui63 root, score: 84.918 | N | N | N | N |
| vg0405740436 | C -> G | LOC_Os04g10550.1 | downstream_gene_variant ; 3373.0bp to feature; MODIFIER | silent_mutation | Average:54.409; most accessible tissue: Minghui63 root, score: 84.918 | N | N | N | N |
| vg0405740436 | C -> G | LOC_Os04g10569.1 | intron_variant ; MODIFIER | silent_mutation | Average:54.409; most accessible tissue: Minghui63 root, score: 84.918 | N | N | N | N |
| vg0405740436 | C -> CGCCTGGA | LOC_Os04g10590.1 | upstream_gene_variant ; 2207.0bp to feature; MODIFIER | silent_mutation | Average:54.409; most accessible tissue: Minghui63 root, score: 84.918 | N | N | N | N |
| vg0405740436 | C -> CGCCTGGA | LOC_Os04g10550.1 | downstream_gene_variant ; 3374.0bp to feature; MODIFIER | silent_mutation | Average:54.409; most accessible tissue: Minghui63 root, score: 84.918 | N | N | N | N |
| vg0405740436 | C -> CGCCTGGA | LOC_Os04g10569.1 | intron_variant ; MODIFIER | silent_mutation | Average:54.409; most accessible tissue: Minghui63 root, score: 84.918 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0405740436 | NA | 5.81E-06 | mr1002 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405740436 | 9.82E-11 | 3.47E-20 | mr1035 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405740436 | 5.36E-07 | 1.09E-06 | mr1035 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405740436 | 6.18E-10 | 5.22E-14 | mr1062 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405740436 | 2.67E-06 | NA | mr1062 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405740436 | 9.36E-10 | NA | mr1525 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405740436 | 4.78E-10 | 3.61E-19 | mr1626 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405740436 | 2.48E-07 | 5.13E-08 | mr1626 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405740436 | 1.73E-08 | 1.80E-25 | mr1631 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405740436 | 2.27E-06 | 2.27E-06 | mr1631 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405740436 | 9.89E-10 | 6.99E-18 | mr1035_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405740436 | 3.15E-15 | 1.43E-21 | mr1062_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405740436 | 1.81E-08 | 3.43E-07 | mr1062_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405740436 | 4.61E-09 | NA | mr1631_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405740436 | NA | 6.46E-06 | mr1631_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405740436 | NA | 9.28E-10 | mr1709_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |