Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0405615364:

Variant ID: vg0405615364 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 5615364
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.68, T: 0.32, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:


AATGAAGTATGTAAATATTTGTTGTTGAAAATTATAAAATAGTGTTTATAAGTTGTTGAGAGATGTGAAACATGAGGGGTCAAGTGACTCGACGGGCTAA[T/C]
ATGTAAAATTGACAAATGGAAATTATATGTGGTGCATAACTACATATTTAACACCATTTGATCTGAGCTGTAGGATTTCTGCCTTGTGGTGATACTCTAT

Reverse complement sequence

ATAGAGTATCACCACAAGGCAGAAATCCTACAGCTCAGATCAAATGGTGTTAAATATGTAGTTATGCACCACATATAATTTCCATTTGTCAATTTTACAT[A/G]
TTAGCCCGTCGAGTCACTTGACCCCTCATGTTTCACATCTCTCAACAACTTATAAACACTATTTTATAATTTTCAACAACAAATATTTACATACTTCATT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.20% 26.70% 0.11% 0.00% NA
All Indica  2759 92.20% 7.70% 0.14% 0.00% NA
All Japonica  1512 32.40% 67.60% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 96.00% 3.90% 0.17% 0.00% NA
Indica II  465 85.40% 14.40% 0.22% 0.00% NA
Indica III  913 95.70% 4.30% 0.00% 0.00% NA
Indica Intermediate  786 89.20% 10.60% 0.25% 0.00% NA
Temperate Japonica  767 35.20% 64.80% 0.00% 0.00% NA
Tropical Japonica  504 33.90% 66.10% 0.00% 0.00% NA
Japonica Intermediate  241 20.30% 79.70% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 71.10% 27.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0405615364 T -> C LOC_Os04g10380.1 intron_variant ; MODIFIER silent_mutation Average:58.254; most accessible tissue: Zhenshan97 young leaf, score: 70.625 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0405615364 3.84E-20 1.12E-35 mr1035 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405615364 1.06E-09 1.19E-11 mr1035 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405615364 5.40E-09 4.85E-12 mr1035 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405615364 5.09E-13 5.39E-29 mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405615364 1.67E-06 4.02E-10 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405615364 3.03E-14 8.37E-10 mr1525 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405615364 1.77E-06 1.50E-06 mr1525 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405615364 1.28E-08 1.28E-08 mr1525 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405615364 2.73E-18 7.71E-31 mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405615364 9.82E-09 4.85E-10 mr1626 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405615364 2.02E-09 6.27E-13 mr1626 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405615364 1.93E-16 7.24E-42 mr1631 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405615364 4.76E-08 3.78E-09 mr1631 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405615364 7.91E-10 7.91E-10 mr1631 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405615364 1.31E-19 5.74E-32 mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405615364 2.06E-10 3.96E-14 mr1035_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405615364 2.48E-21 1.95E-37 mr1062_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405615364 2.08E-08 7.03E-08 mr1062_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405615364 9.42E-11 4.57E-14 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405615364 2.95E-10 3.05E-10 mr1525_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405615364 2.23E-07 4.22E-08 mr1525_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405615364 1.15E-10 1.15E-10 mr1525_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405615364 4.85E-21 2.84E-52 mr1631_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405615364 2.91E-06 5.14E-07 mr1631_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405615364 7.43E-11 5.87E-16 mr1631_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251