\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405488386:

Variant ID: vg0405488386 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 5488386
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.06, others allele: 0.00, population size: 120. )

Flanking Sequence (100 bp) in Reference Genome:


AAGCTCTAGTGGTGAACACAACCAGGTTAGTGCATCAAAATGTGTTCCTGGACGAGGGGTTTCTATTTTGCTTGAACATGCAGGACGAATGGAAGACGAA[G/A]
ACAAATTAACTTATATTGTTCATCGTCTTCCCTAGCTGAAGCTGACGCACTTTAAGAGGATGCGCCGGGGAAGAGAGAGAGAGAGGGAGAGGGCTACTGG

Reverse complement sequence

CCAGTAGCCCTCTCCCTCTCTCTCTCTCTTCCCCGGCGCATCCTCTTAAAGTGCGTCAGCTTCAGCTAGGGAAGACGATGAACAATATAAGTTAATTTGT[C/T]
TTCGTCTTCCATTCGTCCTGCATGTTCAAGCAAAATAGAAACCCCTCGTCCAGGAACACATTTTGATGCACTAACCTGGTTGTGTTCACCACTAGAGCTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.30% 37.50% 0.11% 0.15% NA
All Indica  2759 90.50% 9.20% 0.07% 0.18% NA
All Japonica  1512 2.70% 97.20% 0.00% 0.13% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 96.00% 3.90% 0.00% 0.17% NA
Indica II  465 84.30% 15.10% 0.22% 0.43% NA
Indica III  913 92.00% 7.80% 0.00% 0.22% NA
Indica Intermediate  786 88.40% 11.50% 0.13% 0.00% NA
Temperate Japonica  767 0.50% 99.30% 0.00% 0.13% NA
Tropical Japonica  504 5.00% 94.80% 0.00% 0.20% NA
Japonica Intermediate  241 5.00% 95.00% 0.00% 0.00% NA
VI/Aromatic  96 90.60% 9.40% 0.00% 0.00% NA
Intermediate  90 53.30% 43.30% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0405488386 G -> DEL N N silent_mutation Average:56.223; most accessible tissue: Zhenshan97 young leaf, score: 84.035 N N N N
vg0405488386 G -> A LOC_Os04g10150.1 upstream_gene_variant ; 4128.0bp to feature; MODIFIER silent_mutation Average:56.223; most accessible tissue: Zhenshan97 young leaf, score: 84.035 N N N N
vg0405488386 G -> A LOC_Os04g10160.1 downstream_gene_variant ; 1613.0bp to feature; MODIFIER silent_mutation Average:56.223; most accessible tissue: Zhenshan97 young leaf, score: 84.035 N N N N
vg0405488386 G -> A LOC_Os04g10160-LOC_Os04g10170 intergenic_region ; MODIFIER silent_mutation Average:56.223; most accessible tissue: Zhenshan97 young leaf, score: 84.035 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0405488386 1.57E-09 4.60E-21 mr1035 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405488386 5.01E-11 6.43E-13 mr1035 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405488386 NA 4.09E-15 mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405488386 1.29E-06 2.28E-16 mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405488386 3.03E-09 1.59E-10 mr1626 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405488386 2.29E-08 2.25E-34 mr1631 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405488386 2.34E-09 1.77E-10 mr1631 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405488386 4.44E-07 8.06E-18 mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405488386 9.98E-07 9.98E-07 mr1035_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405488386 NA 3.03E-19 mr1062_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405488386 2.33E-06 2.92E-06 mr1062_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405488386 NA 2.91E-06 mr1369_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405488386 NA 4.05E-06 mr1525_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405488386 6.07E-07 2.51E-37 mr1631_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405488386 7.04E-08 1.58E-08 mr1631_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251