\
| Variant ID: vg0405464016 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 5464016 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, C: 0.01, others allele: 0.00, population size: 120. )
AGATGTCATGGCACAGGGCCGGTGTCCTGCTGCTAGGGGCTCAACCTTGGTTACCTGTCTCGGGAATCCTGGCCGTAGCCAGGGTTGGGTTTGTACTCTT[G/A]
TCTATGGCTAGGATGGGTTGGGAACTATGTCACGTCTTCTGTCCGTATGCCGTGGTGGTATGTGGCGCGTGGTTACACGTGAGGAAAACGTGTCTTGTGG
CCACAAGACACGTTTTCCTCACGTGTAACCACGCGCCACATACCACCACGGCATACGGACAGAAGACGTGACATAGTTCCCAACCCATCCTAGCCATAGA[C/T]
AAGAGTACAAACCCAACCCTGGCTACGGCCAGGATTCCCGAGACAGGTAACCAAGGTTGAGCCCCTAGCAGCAGGACACCGGCCCTGTGCCATGACATCT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.10% | 14.00% | 3.83% | 31.06% | NA |
| All Indica | 2759 | 31.00% | 16.20% | 5.73% | 47.12% | NA |
| All Japonica | 1512 | 97.70% | 0.80% | 0.07% | 1.46% | NA |
| Aus | 269 | 7.40% | 48.30% | 4.09% | 40.15% | NA |
| Indica I | 595 | 21.70% | 2.20% | 5.38% | 70.76% | NA |
| Indica II | 465 | 32.70% | 38.70% | 5.59% | 23.01% | NA |
| Indica III | 913 | 38.20% | 12.90% | 5.26% | 43.59% | NA |
| Indica Intermediate | 786 | 28.60% | 17.20% | 6.62% | 47.58% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 95.60% | 0.60% | 0.20% | 3.57% | NA |
| Japonica Intermediate | 241 | 95.40% | 2.90% | 0.00% | 1.66% | NA |
| VI/Aromatic | 96 | 17.70% | 53.10% | 9.38% | 19.79% | NA |
| Intermediate | 90 | 52.20% | 24.40% | 2.22% | 21.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0405464016 | G -> DEL | LOC_Os04g10120.1 | N | frameshift_variant | Average:38.924; most accessible tissue: Minghui63 panicle, score: 73.225 | N | N | N | N |
| vg0405464016 | G -> A | LOC_Os04g10120.1 | synonymous_variant ; p.Leu51Leu; LOW | synonymous_codon | Average:38.924; most accessible tissue: Minghui63 panicle, score: 73.225 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0405464016 | NA | 1.94E-06 | mr1035 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405464016 | NA | 8.21E-10 | mr1059 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405464016 | 3.56E-06 | 2.60E-09 | mr1062 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405464016 | NA | 9.64E-07 | mr1136 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405464016 | NA | 2.44E-12 | mr1143 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405464016 | NA | 3.94E-11 | mr1167 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405464016 | NA | 2.12E-07 | mr1458 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405464016 | NA | 6.40E-10 | mr1535 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405464016 | NA | 7.05E-07 | mr1626 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405464016 | NA | 2.90E-11 | mr1675 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405464016 | NA | 7.30E-09 | mr1726 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405464016 | NA | 2.22E-08 | mr1950 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405464016 | NA | 7.18E-12 | mr1969 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405464016 | NA | 2.41E-12 | mr1995 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405464016 | 1.28E-06 | 3.79E-15 | mr1062_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405464016 | NA | 2.07E-08 | mr1158_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405464016 | NA | 3.15E-06 | mr1158_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405464016 | NA | 5.02E-08 | mr1167_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405464016 | NA | 5.64E-06 | mr1277_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405464016 | NA | 1.69E-07 | mr1830_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405464016 | NA | 6.11E-06 | mr1971_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |