\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405322574:

Variant ID: vg0405322574 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 5322574
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.62, G: 0.38, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


AATTTTCTAAAAAAAATCCAATCGAATTCCCACGGTGAATTTTACCCTAACTAAACCATATAACAATAATAAAATTAAAATAGTATTTACCCGTTGCAAC[A/G]
CACGGGTATTTTTTCTAGTACAATAAAAAACATTCAATGTTACATTTAATTAAACTAATTTGATGTTATAGATGTTGCTAAATTTTATATAAAATTAAGG

Reverse complement sequence

CCTTAATTTTATATAAAATTTAGCAACATCTATAACATCAAATTAGTTTAATTAAATGTAACATTGAATGTTTTTTATTGTACTAGAAAAAATACCCGTG[T/C]
GTTGCAACGGGTAAATACTATTTTAATTTTATTATTGTTATATGGTTTAGTTAGGGTAAAATTCACCGTGGGAATTCGATTGGATTTTTTTTAGAAAATT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.50% 31.70% 0.34% 12.48% NA
All Indica  2759 79.90% 5.60% 0.43% 14.03% NA
All Japonica  1512 13.20% 85.80% 0.13% 0.79% NA
Aus  269 51.30% 0.70% 0.00% 47.96% NA
Indica I  595 95.30% 3.70% 0.00% 1.01% NA
Indica II  465 58.90% 4.10% 0.22% 36.77% NA
Indica III  913 81.10% 7.30% 0.77% 10.84% NA
Indica Intermediate  786 79.40% 6.00% 0.51% 14.12% NA
Temperate Japonica  767 8.20% 91.40% 0.13% 0.26% NA
Tropical Japonica  504 22.80% 76.60% 0.00% 0.60% NA
Japonica Intermediate  241 9.10% 87.60% 0.41% 2.90% NA
VI/Aromatic  96 40.60% 11.50% 1.04% 46.88% NA
Intermediate  90 43.30% 36.70% 1.11% 18.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0405322574 A -> DEL N N silent_mutation Average:27.22; most accessible tissue: Callus, score: 40.751 N N N N
vg0405322574 A -> G LOC_Os04g09900.1 intron_variant ; MODIFIER silent_mutation Average:27.22; most accessible tissue: Callus, score: 40.751 N N N N
vg0405322574 A -> G LOC_Os04g09900.3 intron_variant ; MODIFIER silent_mutation Average:27.22; most accessible tissue: Callus, score: 40.751 N N N N
vg0405322574 A -> G LOC_Os04g09900.2 intron_variant ; MODIFIER silent_mutation Average:27.22; most accessible tissue: Callus, score: 40.751 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0405322574 NA 3.75E-07 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405322574 NA 5.41E-14 mr1726 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405322574 NA 2.18E-07 mr1804 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405322574 NA 7.60E-13 mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405322574 NA 5.23E-06 mr1566_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405322574 NA 1.75E-16 mr1592_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405322574 NA 9.13E-06 mr1671_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405322574 NA 5.09E-08 mr1837_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405322574 NA 1.79E-14 mr1938_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251