\
| Variant ID: vg0405322574 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 5322574 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.62, G: 0.38, others allele: 0.00, population size: 90. )
AATTTTCTAAAAAAAATCCAATCGAATTCCCACGGTGAATTTTACCCTAACTAAACCATATAACAATAATAAAATTAAAATAGTATTTACCCGTTGCAAC[A/G]
CACGGGTATTTTTTCTAGTACAATAAAAAACATTCAATGTTACATTTAATTAAACTAATTTGATGTTATAGATGTTGCTAAATTTTATATAAAATTAAGG
CCTTAATTTTATATAAAATTTAGCAACATCTATAACATCAAATTAGTTTAATTAAATGTAACATTGAATGTTTTTTATTGTACTAGAAAAAATACCCGTG[T/C]
GTTGCAACGGGTAAATACTATTTTAATTTTATTATTGTTATATGGTTTAGTTAGGGTAAAATTCACCGTGGGAATTCGATTGGATTTTTTTTAGAAAATT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 55.50% | 31.70% | 0.34% | 12.48% | NA |
| All Indica | 2759 | 79.90% | 5.60% | 0.43% | 14.03% | NA |
| All Japonica | 1512 | 13.20% | 85.80% | 0.13% | 0.79% | NA |
| Aus | 269 | 51.30% | 0.70% | 0.00% | 47.96% | NA |
| Indica I | 595 | 95.30% | 3.70% | 0.00% | 1.01% | NA |
| Indica II | 465 | 58.90% | 4.10% | 0.22% | 36.77% | NA |
| Indica III | 913 | 81.10% | 7.30% | 0.77% | 10.84% | NA |
| Indica Intermediate | 786 | 79.40% | 6.00% | 0.51% | 14.12% | NA |
| Temperate Japonica | 767 | 8.20% | 91.40% | 0.13% | 0.26% | NA |
| Tropical Japonica | 504 | 22.80% | 76.60% | 0.00% | 0.60% | NA |
| Japonica Intermediate | 241 | 9.10% | 87.60% | 0.41% | 2.90% | NA |
| VI/Aromatic | 96 | 40.60% | 11.50% | 1.04% | 46.88% | NA |
| Intermediate | 90 | 43.30% | 36.70% | 1.11% | 18.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0405322574 | A -> DEL | N | N | silent_mutation | Average:27.22; most accessible tissue: Callus, score: 40.751 | N | N | N | N |
| vg0405322574 | A -> G | LOC_Os04g09900.1 | intron_variant ; MODIFIER | silent_mutation | Average:27.22; most accessible tissue: Callus, score: 40.751 | N | N | N | N |
| vg0405322574 | A -> G | LOC_Os04g09900.3 | intron_variant ; MODIFIER | silent_mutation | Average:27.22; most accessible tissue: Callus, score: 40.751 | N | N | N | N |
| vg0405322574 | A -> G | LOC_Os04g09900.2 | intron_variant ; MODIFIER | silent_mutation | Average:27.22; most accessible tissue: Callus, score: 40.751 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0405322574 | NA | 3.75E-07 | mr1162 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405322574 | NA | 5.41E-14 | mr1726 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405322574 | NA | 2.18E-07 | mr1804 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405322574 | NA | 7.60E-13 | mr1035_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405322574 | NA | 5.23E-06 | mr1566_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405322574 | NA | 1.75E-16 | mr1592_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405322574 | NA | 9.13E-06 | mr1671_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405322574 | NA | 5.09E-08 | mr1837_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405322574 | NA | 1.79E-14 | mr1938_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |