Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0405322574:

Variant ID: vg0405322574 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 5322574
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.62, G: 0.38, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:

AATTTTCTAAAAAAAATCCAATCGAATTCCCACGGTGAATTTTACCCTAACTAAACCATATAACAATAATAAAATTAAAATAGTATTTACCCGTTGCAAC[A/G]
CACGGGTATTTTTTCTAGTACAATAAAAAACATTCAATGTTACATTTAATTAAACTAATTTGATGTTATAGATGTTGCTAAATTTTATATAAAATTAAGG

Reverse complement sequence

CCTTAATTTTATATAAAATTTAGCAACATCTATAACATCAAATTAGTTTAATTAAATGTAACATTGAATGTTTTTTATTGTACTAGAAAAAATACCCGTG[T/C]
GTTGCAACGGGTAAATACTATTTTAATTTTATTATTGTTATATGGTTTAGTTAGGGTAAAATTCACCGTGGGAATTCGATTGGATTTTTTTTAGAAAATT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	55.50%	31.70%	0.34%	12.48%	NA
All Indica	2759	79.90%	5.60%	0.43%	14.03%	NA
All Japonica	1512	13.20%	85.80%	0.13%	0.79%	NA
Aus	269	51.30%	0.70%	0.00%	47.96%	NA
Indica I	595	95.30%	3.70%	0.00%	1.01%	NA
Indica II	465	58.90%	4.10%	0.22%	36.77%	NA
Indica III	913	81.10%	7.30%	0.77%	10.84%	NA
Indica Intermediate	786	79.40%	6.00%	0.51%	14.12%	NA
Temperate Japonica	767	8.20%	91.40%	0.13%	0.26%	NA
Tropical Japonica	504	22.80%	76.60%	0.00%	0.60%	NA
Japonica Intermediate	241	9.10%	87.60%	0.41%	2.90%	NA
VI/Aromatic	96	40.60%	11.50%	1.04%	46.88%	NA
Intermediate	90	43.30%	36.70%	1.11%	18.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0405322574	A -> DEL	N	N	silent_mutation	Average:27.22; most accessible tissue: Callus, score: 40.751	N	N	N	N
vg0405322574	A -> G	LOC_Os04g09900.1	intron_variant ; MODIFIER	silent_mutation	Average:27.22; most accessible tissue: Callus, score: 40.751	N	N	N	N
vg0405322574	A -> G	LOC_Os04g09900.3	intron_variant ; MODIFIER	silent_mutation	Average:27.22; most accessible tissue: Callus, score: 40.751	N	N	N	N
vg0405322574	A -> G	LOC_Os04g09900.2	intron_variant ; MODIFIER	silent_mutation	Average:27.22; most accessible tissue: Callus, score: 40.751	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0405322574	NA	3.75E-07	mr1162	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405322574	NA	5.41E-14	mr1726	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405322574	NA	2.18E-07	mr1804	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405322574	NA	7.60E-13	mr1035_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405322574	NA	5.23E-06	mr1566_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405322574	NA	1.75E-16	mr1592_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405322574	NA	9.13E-06	mr1671_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405322574	NA	5.09E-08	mr1837_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405322574	NA	1.79E-14	mr1938_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251