Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0405271343:

Variant ID: vg0405271343 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 5271343
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.67, T: 0.32, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:

GATGAGAGGGATAAGACGATTGGATGGAGCGACGTTGGCGATACGACTACAACTATCCAGGGATGTTGTGCCTTAGCAATCGTTACACCAACTCCAGAGG[T/C]
GGTCGTGAATCTTGACGGATGCACAATCACCCAACCACGAGGGTATTTGTTCCTGCAAGCAATCGAGAACCAGCAAGAACAAGATGAATAAGCAACTCAA

Reverse complement sequence

TTGAGTTGCTTATTCATCTTGTTCTTGCTGGTTCTCGATTGCTTGCAGGAACAAATACCCTCGTGGTTGGGTGATTGTGCATCCGTCAAGATTCACGACC[A/G]
CCTCTGGAGTTGGTGTAACGATTGCTAAGGCACAACATCCCTGGATAGTTGTAGTCGTATCGCCAACGTCGCTCCATCCAATCGTCTTATCCCTCTCATC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	57.30%	42.20%	0.30%	0.21%	NA
All Indica	2759	53.90%	45.40%	0.40%	0.29%	NA
All Japonica	1512	73.90%	26.10%	0.00%	0.00%	NA
Aus	269	9.30%	90.30%	0.37%	0.00%	NA
Indica I	595	42.90%	56.30%	0.67%	0.17%	NA
Indica II	465	40.00%	59.60%	0.43%	0.00%	NA
Indica III	913	68.10%	31.30%	0.22%	0.33%	NA
Indica Intermediate	786	53.90%	45.20%	0.38%	0.51%	NA
Temperate Japonica	767	65.60%	34.40%	0.00%	0.00%	NA
Tropical Japonica	504	80.60%	19.40%	0.00%	0.00%	NA
Japonica Intermediate	241	86.30%	13.70%	0.00%	0.00%	NA
VI/Aromatic	96	32.30%	65.60%	0.00%	2.08%	NA
Intermediate	90	51.10%	46.70%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0405271343	T -> C	LOC_Os04g09810.1	upstream_gene_variant ; 4591.0bp to feature; MODIFIER	silent_mutation	Average:47.369; most accessible tissue: Zhenshan97 young leaf, score: 66.32	N	N	N	N
vg0405271343	T -> C	LOC_Os04g09820.1	downstream_gene_variant ; 2948.0bp to feature; MODIFIER	silent_mutation	Average:47.369; most accessible tissue: Zhenshan97 young leaf, score: 66.32	N	N	N	N
vg0405271343	T -> C	LOC_Os04g09810-LOC_Os04g09820	intergenic_region ; MODIFIER	silent_mutation	Average:47.369; most accessible tissue: Zhenshan97 young leaf, score: 66.32	N	N	N	N
vg0405271343	T -> DEL	N	N	silent_mutation	Average:47.369; most accessible tissue: Zhenshan97 young leaf, score: 66.32	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0405271343	NA	4.69E-08	mr1035	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405271343	1.52E-06	1.65E-15	mr1062	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405271343	NA	1.36E-07	mr1062	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405271343	NA	1.72E-07	mr1626	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405271343	NA	5.98E-06	mr1035_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405271343	NA	1.93E-08	mr1062_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405271343	2.51E-07	NA	mr1631_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405271343	NA	2.80E-08	mr1631_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251