Variant ID: vg0405234320 (JBrowse) | Variation Type: SNP |
Chromosome: chr04 | Position: 5234320 |
Reference Allele: C | Alternative Allele: T |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CAAAATTGTTCGAATGAAGCATTTTTAAATTCACGACCATTATCACTTCGAATTCTTTTCAAAGAACCAGGAAATTCAACCTCCAATCGAAGAAACAAAC[C/T]
ACAAAAGTGTTGAAAAGCTTCATCCTTAGTTGCCATAAAGAAAACCCAAGAATATCGAGAAAAATCGACAACAATAACCAACACATACCACTTTCCTCCA
TGGAGGAAAGTGGTATGTGTTGGTTATTGTTGTCGATTTTTCTCGATATTCTTGGGTTTTCTTTATGGCAACTAAGGATGAAGCTTTTCAACACTTTTGT[G/A]
GTTTGTTTCTTCGATTGGAGGTTGAATTTCCTGGTTCTTTGAAAAGAATTCGAAGTGATAATGGTCGTGAATTTAAAAATGCTTCATTCGAACAATTTTG
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 82.90% | 8.60% | 5.97% | 2.54% | NA |
All Indica | 2759 | 88.80% | 1.70% | 6.92% | 2.50% | NA |
All Japonica | 1512 | 70.40% | 22.80% | 3.84% | 2.91% | NA |
Aus | 269 | 99.30% | 0.00% | 0.00% | 0.74% | NA |
Indica I | 595 | 76.60% | 3.40% | 15.46% | 4.54% | NA |
Indica II | 465 | 88.60% | 0.90% | 8.17% | 2.37% | NA |
Indica III | 913 | 98.20% | 0.70% | 0.66% | 0.44% | NA |
Indica Intermediate | 786 | 87.30% | 2.30% | 7.00% | 3.44% | NA |
Temperate Japonica | 767 | 93.60% | 1.70% | 3.65% | 1.04% | NA |
Tropical Japonica | 504 | 31.90% | 56.70% | 4.56% | 6.75% | NA |
Japonica Intermediate | 241 | 77.20% | 19.10% | 2.90% | 0.83% | NA |
VI/Aromatic | 96 | 63.50% | 6.20% | 29.17% | 1.04% | NA |
Intermediate | 90 | 80.00% | 10.00% | 5.56% | 4.44% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0405234320 | C -> DEL | N | N | silent_mutation | Average:12.137; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
vg0405234320 | C -> T | LOC_Os04g09750-LOC_Os04g09770 | intergenic_region ; MODIFIER | silent_mutation | Average:12.137; most accessible tissue: Minghui63 panicle, score: 29.741 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0405234320 | NA | 5.86E-07 | mr1554 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0405234320 | 8.82E-07 | NA | mr1136_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0405234320 | NA | 5.68E-08 | mr1364_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0405234320 | NA | 6.87E-07 | mr1554_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0405234320 | NA | 1.56E-06 | mr1606_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0405234320 | NA | 4.98E-09 | mr1696_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0405234320 | NA | 2.22E-07 | mr1696_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0405234320 | NA | 4.87E-07 | mr1819_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0405234320 | NA | 2.20E-07 | mr1860_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0405234320 | NA | 1.33E-08 | mr1905_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |