\
| Variant ID: vg0405134587 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 5134587 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CAAATTTTTTTTTGCAAATATAAAAAACGTAAAATTGTGCTTAAAGTATTGTAGATAATAAAATAAGTCATAAATAAAATAAATAATAATTTCAAAAAAA[T/A]
TTGAATAAGACGAGTGGTCAATCGTTACAATCAAAAACTCAAAATCCCTTATATTATGGGACAGAGGGAGTATATATTAAAGACTACTCCCTCCGTTTCA
TGAAACGGAGGGAGTAGTCTTTAATATATACTCCCTCTGTCCCATAATATAAGGGATTTTGAGTTTTTGATTGTAACGATTGACCACTCGTCTTATTCAA[A/T]
TTTTTTTGAAATTATTATTTATTTTATTTATGACTTATTTTATTATCTACAATACTTTAAGCACAATTTTACGTTTTTTATATTTGCAAAAAAAAATTTG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 78.50% | 18.30% | 0.38% | 2.86% | NA |
| All Indica | 2759 | 95.00% | 2.40% | 0.14% | 2.50% | NA |
| All Japonica | 1512 | 43.80% | 51.20% | 0.79% | 4.17% | NA |
| Aus | 269 | 98.90% | 0.70% | 0.00% | 0.37% | NA |
| Indica I | 595 | 96.80% | 2.70% | 0.00% | 0.50% | NA |
| Indica II | 465 | 91.00% | 2.80% | 0.00% | 6.24% | NA |
| Indica III | 913 | 97.30% | 1.60% | 0.22% | 0.88% | NA |
| Indica Intermediate | 786 | 93.40% | 2.70% | 0.25% | 3.69% | NA |
| Temperate Japonica | 767 | 42.80% | 56.30% | 0.78% | 0.13% | NA |
| Tropical Japonica | 504 | 34.90% | 52.00% | 0.79% | 12.30% | NA |
| Japonica Intermediate | 241 | 66.00% | 33.20% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 91.70% | 8.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 78.90% | 16.70% | 2.22% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0405134587 | T -> DEL | N | N | silent_mutation | Average:29.482; most accessible tissue: Zhenshan97 panicle, score: 74.671 | N | N | N | N |
| vg0405134587 | T -> A | LOC_Os04g09560.1 | upstream_gene_variant ; 2034.0bp to feature; MODIFIER | silent_mutation | Average:29.482; most accessible tissue: Zhenshan97 panicle, score: 74.671 | N | N | N | N |
| vg0405134587 | T -> A | LOC_Os04g09570.1 | upstream_gene_variant ; 641.0bp to feature; MODIFIER | silent_mutation | Average:29.482; most accessible tissue: Zhenshan97 panicle, score: 74.671 | N | N | N | N |
| vg0405134587 | T -> A | LOC_Os04g09550.1 | downstream_gene_variant ; 4783.0bp to feature; MODIFIER | silent_mutation | Average:29.482; most accessible tissue: Zhenshan97 panicle, score: 74.671 | N | N | N | N |
| vg0405134587 | T -> A | LOC_Os04g09580.1 | downstream_gene_variant ; 640.0bp to feature; MODIFIER | silent_mutation | Average:29.482; most accessible tissue: Zhenshan97 panicle, score: 74.671 | N | N | N | N |
| vg0405134587 | T -> A | LOC_Os04g09560-LOC_Os04g09580 | intergenic_region ; MODIFIER | silent_mutation | Average:29.482; most accessible tissue: Zhenshan97 panicle, score: 74.671 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0405134587 | NA | 4.81E-08 | mr1554 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405134587 | NA | 2.30E-09 | mr1578 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405134587 | 1.85E-07 | 3.19E-07 | mr1602 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405134587 | NA | 2.02E-07 | mr1602 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405134587 | NA | 8.69E-06 | mr1416_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |