Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0405134587:

Variant ID: vg0405134587 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 5134587
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CAAATTTTTTTTTGCAAATATAAAAAACGTAAAATTGTGCTTAAAGTATTGTAGATAATAAAATAAGTCATAAATAAAATAAATAATAATTTCAAAAAAA[T/A]
TTGAATAAGACGAGTGGTCAATCGTTACAATCAAAAACTCAAAATCCCTTATATTATGGGACAGAGGGAGTATATATTAAAGACTACTCCCTCCGTTTCA

Reverse complement sequence

TGAAACGGAGGGAGTAGTCTTTAATATATACTCCCTCTGTCCCATAATATAAGGGATTTTGAGTTTTTGATTGTAACGATTGACCACTCGTCTTATTCAA[A/T]
TTTTTTTGAAATTATTATTTATTTTATTTATGACTTATTTTATTATCTACAATACTTTAAGCACAATTTTACGTTTTTTATATTTGCAAAAAAAAATTTG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	78.50%	18.30%	0.38%	2.86%	NA
All Indica	2759	95.00%	2.40%	0.14%	2.50%	NA
All Japonica	1512	43.80%	51.20%	0.79%	4.17%	NA
Aus	269	98.90%	0.70%	0.00%	0.37%	NA
Indica I	595	96.80%	2.70%	0.00%	0.50%	NA
Indica II	465	91.00%	2.80%	0.00%	6.24%	NA
Indica III	913	97.30%	1.60%	0.22%	0.88%	NA
Indica Intermediate	786	93.40%	2.70%	0.25%	3.69%	NA
Temperate Japonica	767	42.80%	56.30%	0.78%	0.13%	NA
Tropical Japonica	504	34.90%	52.00%	0.79%	12.30%	NA
Japonica Intermediate	241	66.00%	33.20%	0.83%	0.00%	NA
VI/Aromatic	96	91.70%	8.30%	0.00%	0.00%	NA
Intermediate	90	78.90%	16.70%	2.22%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0405134587	T -> DEL	N	N	silent_mutation	Average:29.482; most accessible tissue: Zhenshan97 panicle, score: 74.671	N	N	N	N
vg0405134587	T -> A	LOC_Os04g09560.1	upstream_gene_variant ; 2034.0bp to feature; MODIFIER	silent_mutation	Average:29.482; most accessible tissue: Zhenshan97 panicle, score: 74.671	N	N	N	N
vg0405134587	T -> A	LOC_Os04g09570.1	upstream_gene_variant ; 641.0bp to feature; MODIFIER	silent_mutation	Average:29.482; most accessible tissue: Zhenshan97 panicle, score: 74.671	N	N	N	N
vg0405134587	T -> A	LOC_Os04g09550.1	downstream_gene_variant ; 4783.0bp to feature; MODIFIER	silent_mutation	Average:29.482; most accessible tissue: Zhenshan97 panicle, score: 74.671	N	N	N	N
vg0405134587	T -> A	LOC_Os04g09580.1	downstream_gene_variant ; 640.0bp to feature; MODIFIER	silent_mutation	Average:29.482; most accessible tissue: Zhenshan97 panicle, score: 74.671	N	N	N	N
vg0405134587	T -> A	LOC_Os04g09560-LOC_Os04g09580	intergenic_region ; MODIFIER	silent_mutation	Average:29.482; most accessible tissue: Zhenshan97 panicle, score: 74.671	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0405134587	NA	4.81E-08	mr1554	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405134587	NA	2.30E-09	mr1578	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405134587	1.85E-07	3.19E-07	mr1602	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405134587	NA	2.02E-07	mr1602	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405134587	NA	8.69E-06	mr1416_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251