\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405116756:

Variant ID: vg0405116756 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 5116756
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:


GACAAGTCATGTGAGAACAATAAGGCTCTGTTTAGATATAGGGTTGTAAAGTTTTGACGTGTCACATCGGATATACGGATACATATTTGAAGTATTAAAC[A/G]
TAGACTAATAACAAAACAAATTACAGAATCCGTCTGTAAACTGTGAGACGAATTTATTAAGCCTAATTAATCCGTCATTAGCAAATATTTACTGTAGCAC

Reverse complement sequence

GTGCTACAGTAAATATTTGCTAATGACGGATTAATTAGGCTTAATAAATTCGTCTCACAGTTTACAGACGGATTCTGTAATTTGTTTTGTTATTAGTCTA[T/C]
GTTTAATACTTCAAATATGTATCCGTATATCCGATGTGACACGTCAAAACTTTACAACCCTATATCTAAACAGAGCCTTATTGTTCTCACATGACTTGTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.30% 12.30% 2.45% 2.92% NA
All Indica  2759 90.70% 1.00% 3.84% 4.42% NA
All Japonica  1512 64.00% 35.80% 0.13% 0.07% NA
Aus  269 94.40% 0.40% 1.86% 3.35% NA
Indica I  595 88.20% 1.00% 8.91% 1.85% NA
Indica II  465 96.60% 0.60% 2.15% 0.65% NA
Indica III  913 87.60% 0.20% 2.41% 9.75% NA
Indica Intermediate  786 92.70% 2.20% 2.67% 2.42% NA
Temperate Japonica  767 58.80% 41.10% 0.13% 0.00% NA
Tropical Japonica  504 81.90% 17.70% 0.20% 0.20% NA
Japonica Intermediate  241 42.70% 57.30% 0.00% 0.00% NA
VI/Aromatic  96 93.80% 0.00% 2.08% 4.17% NA
Intermediate  90 85.60% 11.10% 1.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0405116756 A -> DEL N N silent_mutation Average:52.396; most accessible tissue: Zhenshan97 root, score: 76.397 N N N N
vg0405116756 A -> G LOC_Os04g09530.1 upstream_gene_variant ; 3118.0bp to feature; MODIFIER silent_mutation Average:52.396; most accessible tissue: Zhenshan97 root, score: 76.397 N N N N
vg0405116756 A -> G LOC_Os04g09540.1 upstream_gene_variant ; 4271.0bp to feature; MODIFIER silent_mutation Average:52.396; most accessible tissue: Zhenshan97 root, score: 76.397 N N N N
vg0405116756 A -> G LOC_Os04g09530.2 upstream_gene_variant ; 3040.0bp to feature; MODIFIER silent_mutation Average:52.396; most accessible tissue: Zhenshan97 root, score: 76.397 N N N N
vg0405116756 A -> G LOC_Os04g09530-LOC_Os04g09540 intergenic_region ; MODIFIER silent_mutation Average:52.396; most accessible tissue: Zhenshan97 root, score: 76.397 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0405116756 NA 5.63E-07 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405116756 NA 5.02E-06 mr1262 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405116756 6.08E-08 1.03E-06 mr1602 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405116756 NA 3.74E-07 mr1602 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405116756 NA 2.31E-07 mr1606 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405116756 8.71E-06 NA mr1631_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251