\
| Variant ID: vg0405116756 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 5116756 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 101. )
GACAAGTCATGTGAGAACAATAAGGCTCTGTTTAGATATAGGGTTGTAAAGTTTTGACGTGTCACATCGGATATACGGATACATATTTGAAGTATTAAAC[A/G]
TAGACTAATAACAAAACAAATTACAGAATCCGTCTGTAAACTGTGAGACGAATTTATTAAGCCTAATTAATCCGTCATTAGCAAATATTTACTGTAGCAC
GTGCTACAGTAAATATTTGCTAATGACGGATTAATTAGGCTTAATAAATTCGTCTCACAGTTTACAGACGGATTCTGTAATTTGTTTTGTTATTAGTCTA[T/C]
GTTTAATACTTCAAATATGTATCCGTATATCCGATGTGACACGTCAAAACTTTACAACCCTATATCTAAACAGAGCCTTATTGTTCTCACATGACTTGTC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 82.30% | 12.30% | 2.45% | 2.92% | NA |
| All Indica | 2759 | 90.70% | 1.00% | 3.84% | 4.42% | NA |
| All Japonica | 1512 | 64.00% | 35.80% | 0.13% | 0.07% | NA |
| Aus | 269 | 94.40% | 0.40% | 1.86% | 3.35% | NA |
| Indica I | 595 | 88.20% | 1.00% | 8.91% | 1.85% | NA |
| Indica II | 465 | 96.60% | 0.60% | 2.15% | 0.65% | NA |
| Indica III | 913 | 87.60% | 0.20% | 2.41% | 9.75% | NA |
| Indica Intermediate | 786 | 92.70% | 2.20% | 2.67% | 2.42% | NA |
| Temperate Japonica | 767 | 58.80% | 41.10% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 81.90% | 17.70% | 0.20% | 0.20% | NA |
| Japonica Intermediate | 241 | 42.70% | 57.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 93.80% | 0.00% | 2.08% | 4.17% | NA |
| Intermediate | 90 | 85.60% | 11.10% | 1.11% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0405116756 | A -> DEL | N | N | silent_mutation | Average:52.396; most accessible tissue: Zhenshan97 root, score: 76.397 | N | N | N | N |
| vg0405116756 | A -> G | LOC_Os04g09530.1 | upstream_gene_variant ; 3118.0bp to feature; MODIFIER | silent_mutation | Average:52.396; most accessible tissue: Zhenshan97 root, score: 76.397 | N | N | N | N |
| vg0405116756 | A -> G | LOC_Os04g09540.1 | upstream_gene_variant ; 4271.0bp to feature; MODIFIER | silent_mutation | Average:52.396; most accessible tissue: Zhenshan97 root, score: 76.397 | N | N | N | N |
| vg0405116756 | A -> G | LOC_Os04g09530.2 | upstream_gene_variant ; 3040.0bp to feature; MODIFIER | silent_mutation | Average:52.396; most accessible tissue: Zhenshan97 root, score: 76.397 | N | N | N | N |
| vg0405116756 | A -> G | LOC_Os04g09530-LOC_Os04g09540 | intergenic_region ; MODIFIER | silent_mutation | Average:52.396; most accessible tissue: Zhenshan97 root, score: 76.397 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0405116756 | NA | 5.63E-07 | mr1002 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405116756 | NA | 5.02E-06 | mr1262 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405116756 | 6.08E-08 | 1.03E-06 | mr1602 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405116756 | NA | 3.74E-07 | mr1602 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405116756 | NA | 2.31E-07 | mr1606 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405116756 | 8.71E-06 | NA | mr1631_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |