| Variant ID: vg0405066237 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 5066237 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 63. )
GAAGCACATTAACCCAACCCGACAACGTATGCCATGTCATATTGTCGGATTTTACTCAATGGGCTAACCTTGTCTAGCTCGGACTCTGTCGATCCTGGTC[A/G]
CAGCCGATTCGGACTTTAGCTTATTCTTGCTCTGCTTGCGGGACGATCTCTATCTTGGATTCCACTTCGATTTTATCTTTGTCTTTGATACTGAAATTAC
GTAATTTCAGTATCAAAGACAAAGATAAAATCGAAGTGGAATCCAAGATAGAGATCGTCCCGCAAGCAGAGCAAGAATAAGCTAAAGTCCGAATCGGCTG[T/C]
GACCAGGATCGACAGAGTCCGAGCTAGACAAGGTTAGCCCATTGAGTAAAATCCGACAATATGACATGGCATACGTTGTCGGGTTGGGTTAATGTGCTTC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 74.00% | 23.60% | 0.17% | 2.20% | NA |
| All Indica | 2759 | 94.60% | 3.60% | 0.14% | 1.63% | NA |
| All Japonica | 1512 | 30.80% | 65.30% | 0.07% | 3.84% | NA |
| Aus | 269 | 98.50% | 1.10% | 0.37% | 0.00% | NA |
| Indica I | 595 | 96.10% | 3.00% | 0.17% | 0.67% | NA |
| Indica II | 465 | 90.50% | 4.10% | 0.22% | 5.16% | NA |
| Indica III | 913 | 97.50% | 2.30% | 0.00% | 0.22% | NA |
| Indica Intermediate | 786 | 92.60% | 5.20% | 0.25% | 1.91% | NA |
| Temperate Japonica | 767 | 18.50% | 81.40% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 36.10% | 52.60% | 0.20% | 11.11% | NA |
| Japonica Intermediate | 241 | 58.90% | 40.70% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 91.70% | 8.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 74.40% | 22.20% | 2.22% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0405066237 | A -> DEL | N | N | silent_mutation | Average:33.308; most accessible tissue: Zhenshan97 flag leaf, score: 74.825 | N | N | N | N |
| vg0405066237 | A -> G | LOC_Os04g09470.1 | downstream_gene_variant ; 4346.0bp to feature; MODIFIER | silent_mutation | Average:33.308; most accessible tissue: Zhenshan97 flag leaf, score: 74.825 | N | N | N | N |
| vg0405066237 | A -> G | LOC_Os04g09460.1 | intron_variant ; MODIFIER | silent_mutation | Average:33.308; most accessible tissue: Zhenshan97 flag leaf, score: 74.825 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0405066237 | NA | 3.16E-17 | mr1035 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405066237 | NA | 9.99E-08 | mr1162 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405066237 | NA | 6.44E-15 | mr1626 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405066237 | NA | 2.03E-26 | mr1631 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405066237 | NA | 1.48E-09 | mr1637 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405066237 | NA | 6.78E-10 | mr1804 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405066237 | NA | 1.78E-15 | mr1035_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405066237 | NA | 2.29E-26 | mr1617_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405066237 | NA | 8.22E-06 | mr1617_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |