Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0405066237:

Variant ID: vg0405066237 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 5066237
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 63. )

Flanking Sequence (100 bp) in Reference Genome:

GAAGCACATTAACCCAACCCGACAACGTATGCCATGTCATATTGTCGGATTTTACTCAATGGGCTAACCTTGTCTAGCTCGGACTCTGTCGATCCTGGTC[A/G]
CAGCCGATTCGGACTTTAGCTTATTCTTGCTCTGCTTGCGGGACGATCTCTATCTTGGATTCCACTTCGATTTTATCTTTGTCTTTGATACTGAAATTAC

Reverse complement sequence

GTAATTTCAGTATCAAAGACAAAGATAAAATCGAAGTGGAATCCAAGATAGAGATCGTCCCGCAAGCAGAGCAAGAATAAGCTAAAGTCCGAATCGGCTG[T/C]
GACCAGGATCGACAGAGTCCGAGCTAGACAAGGTTAGCCCATTGAGTAAAATCCGACAATATGACATGGCATACGTTGTCGGGTTGGGTTAATGTGCTTC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	74.00%	23.60%	0.17%	2.20%	NA
All Indica	2759	94.60%	3.60%	0.14%	1.63%	NA
All Japonica	1512	30.80%	65.30%	0.07%	3.84%	NA
Aus	269	98.50%	1.10%	0.37%	0.00%	NA
Indica I	595	96.10%	3.00%	0.17%	0.67%	NA
Indica II	465	90.50%	4.10%	0.22%	5.16%	NA
Indica III	913	97.50%	2.30%	0.00%	0.22%	NA
Indica Intermediate	786	92.60%	5.20%	0.25%	1.91%	NA
Temperate Japonica	767	18.50%	81.40%	0.00%	0.13%	NA
Tropical Japonica	504	36.10%	52.60%	0.20%	11.11%	NA
Japonica Intermediate	241	58.90%	40.70%	0.00%	0.41%	NA
VI/Aromatic	96	91.70%	8.30%	0.00%	0.00%	NA
Intermediate	90	74.40%	22.20%	2.22%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0405066237	A -> DEL	N	N	silent_mutation	Average:33.308; most accessible tissue: Zhenshan97 flag leaf, score: 74.825	N	N	N	N
vg0405066237	A -> G	LOC_Os04g09470.1	downstream_gene_variant ; 4346.0bp to feature; MODIFIER	silent_mutation	Average:33.308; most accessible tissue: Zhenshan97 flag leaf, score: 74.825	N	N	N	N
vg0405066237	A -> G	LOC_Os04g09460.1	intron_variant ; MODIFIER	silent_mutation	Average:33.308; most accessible tissue: Zhenshan97 flag leaf, score: 74.825	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0405066237	NA	3.16E-17	mr1035	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405066237	NA	9.99E-08	mr1162	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405066237	NA	6.44E-15	mr1626	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405066237	NA	2.03E-26	mr1631	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405066237	NA	1.48E-09	mr1637	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405066237	NA	6.78E-10	mr1804	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405066237	NA	1.78E-15	mr1035_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405066237	NA	2.29E-26	mr1617_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405066237	NA	8.22E-06	mr1617_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251