\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405066237:

Variant ID: vg0405066237 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 5066237
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 63. )

Flanking Sequence (100 bp) in Reference Genome:


GAAGCACATTAACCCAACCCGACAACGTATGCCATGTCATATTGTCGGATTTTACTCAATGGGCTAACCTTGTCTAGCTCGGACTCTGTCGATCCTGGTC[A/G]
CAGCCGATTCGGACTTTAGCTTATTCTTGCTCTGCTTGCGGGACGATCTCTATCTTGGATTCCACTTCGATTTTATCTTTGTCTTTGATACTGAAATTAC

Reverse complement sequence

GTAATTTCAGTATCAAAGACAAAGATAAAATCGAAGTGGAATCCAAGATAGAGATCGTCCCGCAAGCAGAGCAAGAATAAGCTAAAGTCCGAATCGGCTG[T/C]
GACCAGGATCGACAGAGTCCGAGCTAGACAAGGTTAGCCCATTGAGTAAAATCCGACAATATGACATGGCATACGTTGTCGGGTTGGGTTAATGTGCTTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.00% 23.60% 0.17% 2.20% NA
All Indica  2759 94.60% 3.60% 0.14% 1.63% NA
All Japonica  1512 30.80% 65.30% 0.07% 3.84% NA
Aus  269 98.50% 1.10% 0.37% 0.00% NA
Indica I  595 96.10% 3.00% 0.17% 0.67% NA
Indica II  465 90.50% 4.10% 0.22% 5.16% NA
Indica III  913 97.50% 2.30% 0.00% 0.22% NA
Indica Intermediate  786 92.60% 5.20% 0.25% 1.91% NA
Temperate Japonica  767 18.50% 81.40% 0.00% 0.13% NA
Tropical Japonica  504 36.10% 52.60% 0.20% 11.11% NA
Japonica Intermediate  241 58.90% 40.70% 0.00% 0.41% NA
VI/Aromatic  96 91.70% 8.30% 0.00% 0.00% NA
Intermediate  90 74.40% 22.20% 2.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0405066237 A -> DEL N N silent_mutation Average:33.308; most accessible tissue: Zhenshan97 flag leaf, score: 74.825 N N N N
vg0405066237 A -> G LOC_Os04g09470.1 downstream_gene_variant ; 4346.0bp to feature; MODIFIER silent_mutation Average:33.308; most accessible tissue: Zhenshan97 flag leaf, score: 74.825 N N N N
vg0405066237 A -> G LOC_Os04g09460.1 intron_variant ; MODIFIER silent_mutation Average:33.308; most accessible tissue: Zhenshan97 flag leaf, score: 74.825 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0405066237 NA 3.16E-17 mr1035 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405066237 NA 9.99E-08 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405066237 NA 6.44E-15 mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405066237 NA 2.03E-26 mr1631 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405066237 NA 1.48E-09 mr1637 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405066237 NA 6.78E-10 mr1804 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405066237 NA 1.78E-15 mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405066237 NA 2.29E-26 mr1617_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405066237 NA 8.22E-06 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251